Description :
From Genome Similarity Track
Location :
scaffold_70:45065- 46422
Sequence
1357 bases(100 bases per row)
TGTGCCTTCAGTCTTTGCGAATTGTTACCCAATCAAGACGAAATCATCAAAAGCATTAAGATTGTTGGCATTACTAGATTCTGGGCCCGCGATCCGAATT
TGACGGGCGATAAAGAATGAGATGATGCAAATTCATGGCATATCAATGCTTATCTTCTGTCATTGGACGCGTCTGTTAACTAAGCAATAGTTTTGCTTGT
TGAGGAAAAGGATTTCAAACCGGACTCGACGGTGATGAAcctaaaaatattatttcttTCAAACTATATGAAAGGATCCTATACGTAGTGGGTTGATAAA
CCGTTTAAATTTTGTACCTGGAAATGAAAAATTTACTCTGACAACGAGAGCTGTTCAGAAATTCCCACAGACGTAATCTTTTGTTTAAATGATACTTCAG
TTAACGTAGTAGTCTACAGTGTCTTTTAGAGTGTTAACGATGATATTCCACTGGTGCTCGACAATACCAATGCTTTTGAGTCTGAAGTTGTACCATCGGT
GTGTTAGTATGAAGTTACGTTATTGCTGTCCCAATGTATGTCAAACTGAAGAAAGCGGTGCGATAAATTATTACAAGAGCCAATACTTGCGTTGCTGTGT
CAGCCGTGAGACCAGCCACGTATAATCAGAGAGAGTAGTCATATGTTAATAGCATCTATTGATAAGTAAAAAGCTGGATATGCATAGGTGATGAAAAACT
GATTGTGGGTATGAAAAATCAGAACTCATTTCGTCAGACGCTACATAGATTCGACAATCAAGGAATGCATAGAATTTACACAATCGCAATCTGTACATCA
TTAGGCGGTATCTCACATTTCGGTGTTTTACTGCGAAGAAACTCTTACGAACCAGCATCAATGGCGATGTCTCGGCACTGATTTATGGAGTATTGTTCGG
GATGATCGTTTTCAGCCTATCATTCGGAGTGAAAAGCCACCTTTGCCTTACATGTATGCACTTGCCTTGATTGCTCCTATGTGTAGTCAAGTATGTTCGT
GATGAAAGCTTTCGCTCGGCATCTCGGTCGAATAAAATTAAGAATCGAACGATCGCTCATCAACACCAAAATTGCTAAAAATCTGTCACAATCAGAGCGA
AGTTTAGCTTTCAATATTGCTATTCAGGTCTCTCCCTAGCAACTTAGCTACGGCTTAGAAATCaaattcttgtttaagtgtctGCGTATAGTGGCAAAGC
AGATTTTTATTTGTCGTTTCTGTGATGACTTTAACTATAAGTTCCAGTTTACTAGGATAAGCGGAGTCTCTCGAAGTGATCAACACACAGGGACAATTGC
GATGCACCTGACGAGTAATTATAAATCAACAACAGTCTTGATCTATTTGATATACCG