Description :
From Genome Similarity Track
Location :
Scaffold_818:4506- 7547
Sequence
3041 bases(100 bases per row)
AGACGTGTCTTTCTTGTTTCCCGTGCGACGCTTCTTCTTCGACTTCGAGTTGGAACCCTGAGGTTCCTTGCTTGACTCAGAACGGGGGCGCTTAGCAGGA
GGCTTGACTTCCAGGGGTTCTTCTACCCCATTGTCGTCCTCTGCGTTGTCGTCGTCCTCTGCGTCGTCGTCGCCCTCTGCGGCCTCGACGTCCTCCAGAG
TTTCAGGGGAACCTCCTCCTCCTCTTCAGAGCTACTACTAGAGGCGCTCTCCTCAGGTTCCTGGGCGGGAGGCTGATAGTCCGGGTCGTTCTCGATGTCG
TCCACCGTGGAATCGGCGTCCTCATCAGGGTACACCATGTGGGTCATCGAGGTTCCCCCAGGGTGGTGGCACATCACCGCACGTGTCCAGACGCTCGTCC
GCCGTTTCGTAGTAAGCCTCAGGGGCGTATTTGCGCCAGGGAGTCCGATCGAGACGACGCCAGTACATCATACTCACGAGCATCTTGATCAGCTGCGGCT
GTCGGAAATGCCTGTGGGCCGCCCGGCTCGCTCCATGGCTGTGTCGTACTTGAGCCCAGCAAGAATAGCCTGACGCACGTCTGGCCGAACTTCCTTCCAG
ACGACACCCCCAGGGAGCATCGTGTGTGCGGCCTCCTTGGACACCACAGTCTTCTCGCCAGCGCGACGCACAGAGTCGCGGCCAGGCTGATGATCCTTGG
GACGACGCTGGACCTTGTGAACCTGGGGGCTTGCGGAGTTCGACTGCGTTTTTGGCACCTCAGAGTCCCGTGATTTTCTGGAGCCTTGACCGTTCTTGGA
ACCCTGAGATTTTCTGGAATCCTAAGTTTTGCCTCCGGCCTTCGCGCCGCTGCGAGACTTGCTGCCAGGACCCGTGAGATCCAGAATTTCAGGACGACGG
ACGACCCAGACCCTGAAGACGGAGGCATACGCGTGCTCTTCTCTGGATACGGGGCCGCCGCAGCCTTGCGCTTGTCCATGGCTGTGACGTTGATGACAGT
GTCCCAGGATTCAGGAGGCTTCGAGTCCTTGATGCAGAGATTGAAGAGGTCGTGGAGACGCTCCCAATTGCCCGTGAAGTCTGTGTGCTCCTGGAGGAAG
TCAGGGAACTTCCAGGGGTCCACGGTGGCTAACTCAAGACGCGATTTCAGGATTCGCACTTGTGCCTCAGAGTCGGCAAGGCGCGCCTTGAGTTGTGCCT
TCTCGGACTCCAGAGAATCAATCTCGTCTTGGTACCGCGTCTTTTGCTCGCCCAGCGCGACTTTGTACTTGGATTCAGCATCATCCACCTTGCCCAGGGC
CTCTTGGACCTCCAAGAACCAGTAGTCGCACGTGAATTTCCAGGTGCGCTTCAGTTCCTTATACTTGCGTCGCGTGTCGACTACTTCCTGAGTGGCGGTG
AAACCCTGCTGAGAGTCAGCCAGAGAACGCATGTTTCGGTAGGCCCCGAGGACTCGACGCAGGTAACCAGTCATCTTGAACACGCGCTCAGCGAGCCTTG
TGCTGTTGAAGTGACGCAGGAGTGAGGCCATCTCGCGTCGAATGCCGATGGAATTCAGGGTGTTGTCCAACTCGAATGCGGAAAGAGGCGAACGACGTGG
ACACAGGACGTCGATCCCAGCGTTGGCACCGCAGACTTCCTTCAACCCCTGAAGATTCTCGTCGGAGAGCTCCTCGAAGCCGATCAGCGTAGACGCGCCG
CCGTAGCCTTCCATGGCGAATGCACCCGCGCGAATGTCGTTCACGATCCCTGGGACTCCCACGAGATATGCGTTGGTCTTGAGATCCGGCGGGGTTGGCA
GTGTCCAATGCGGTGGGTGCACAGGGAGTACGAAGTCGGGGACATCCACCTCCTGCTGCCGAAGCATACCCGCGAAGACGAGCCCCCTGACGTCCTCCAG
CGTCGCGTGTCGTGGTAACTTGAACTCAGGGGCATCCTCCAGGTTCACGTCCGCAGCCGTGTCGCCTGCGTCTGGAGCTTTAGACTCTGAGTTCGCGTCA
CCAGTTTCCTGGGCTGCAGCGTCAGCCGAGGCAGTGCCATCGGCCTCGCGCATATTCGCGTCAGAGGTTTTGCCCGCGTCGCCGGAGAAGGAGACGCGCT
TAGTTTCCCCCGTCCTGGTGACGCCCGCCGAAGTGTTGCTGGACGCTGAGTTGCCCGCCTGGTCGCCGCCGCCGCCCGCTGGAGCGGTGTTCGCAGGAGC
GTCGCCGGTGCGCTGCTGCGTCGGAGGTGGCGCGCTGCAGGGGGGCGCCGTGCCTTGAGCTGGCACCGTCGCTTGCTTGCCGTCCGAAGGCACGCTCTCC
GCCATGTTGATGATCTGTGAAATGGCGATGTGACCGCGCATTGCCCGTTGGAGTTTTTGCGTTTGAGAAGAGAACCTTGAAGATAGGTCCTGACCAACCG
TTGGGTAGACAGGGTGTCGCCAAAGTGAGTGAAATCCTGGGAGTCGACAGAGTGCGACGGCCGTATCGAAGTCGACGGTGGATCGCCCTCTGTGTTTGTG
TGGCCTGGCCATGATTCACCGGTTCGGAGTTATTTCCTCTTTGATGTACCTGGACCAGGAGGGGCGGTTGACACGAGGCGGTCCCCAGAAAATCGCCGAC
GATGTGCCGCCACCCTTTGGACTTGGAGTTTGTATTGGATGCTGATTGGTGGATGACTTGGATACGGCGCGGCTGTACCCGTGTGACATGGATGGCGACT
GTGGGAGAGAAGTGATTTCTCGGGGTGAATCCAGCGCCTGACCACAGATGGGCCCAACTGGCTGGAAGTGTGAATCCTGGGAGTGCACGCCCAGGATTTC
AGAGAACACTCATTCCAGCCGCGGACTTTCCCTTACGATGAGTGCCTAAAGTCGTGGAAAGTGTCTCTGGCGAATGTATCCCAGAGTACACCTCATCTTG
CTGTGGCTCAAGTAGTATATAACATCATAAAATGAGGTTAGTTTTTCACGAAATATGACATTAGCGAGATTTCTTGTTGAAGCTCTACATCATTAGAATT
TCAAGTGATATAAAGTTGTTCAGACCCGGTTTAGATCTCCT