Description :
From Genome Similarity Track
Location :
contig_21:450588- 452600
Transcript NameFunction/comments
g3911.t1ATP-dependent DNA helicase Q 1
g3912.t1DNA-directed RNA polymerases III 12.5 kDa polypeptide
g3913.t1hypothetical protein PHYSODRAFT_493381

Sequence
2012 bases(100 bases per row)
CCGCACCCAACGCGCCGCCCGCATGAGCCGTTAGCCGCTGCGTTGTTCCAGTACTTTTAACTAATGTGTCGTTTGTAGGGATGTCCTACGCCCGCGGAAT
TTCATGAGAGCGAAAGCAAGGATGTCTGTGTTGTGGTTTACCCCCAAGCTGGTTAGTCGTTCCACTGCTTCTTGCACTGCACGCACTTGTAGAAGGTCGT
GGAAGGCTCGTCCGCCGACCGGATCTGGATCTGCATGAAGTACGCCTTGGTGTGTTCGCAGTGAGGGCAGCGCGCTGCACACACGAAGCACAAGAACAGC
CGCAGGTCAGCAATTAACATCCCGCAGCCAATCGCCAGCCAACAACTCTACGCACTCTCCGTCTGGTCGACGTTCTCCCAGGCTTCGTCTCCGCCTAACA
CGTCGTCCACCTGCTTGCGCTGCAGTGGCACCTTCTTCTCCACCTTGTCGTTGATCTGGAAGAGATACGGGCATGTCTGGCAGAAGAAACGCATGCCGTC
GGACTGCAATAGGCACAAAGCACAACAGTCAGCAATAGCCCACAGCAGTTGCAGCCACACGGCGCACGAACGTCGGGCTCCACGAGCAGGATATTGCCGC
AGGATGGACAGAATTGCATTGTTGAGGGCTGGATGAATGGCGAATGAAGGTCGAAAGCATTTTTGGCATATTGTTGAATTTATTTCCCGTATTTAAGGCA
TTAATTTAGGGTCCTATCAAAAACCTAAGTTTAGGGTCGTGTCAAAAAACACCCACAGGGCACTTTTTGCCCTAACAAAAACACCCTGGGTTTTGCATCG
GGGAACCCATTAGGGCTAGGTGGCGAGAGCATCGTGGTACTGCCCAAATATTATTTTGGCGGCCGTTTAAATGGCTCGGAAAGTCGGAAAGTAGGCAATT
CACACTCCAGTGGAGGATAAGTTGCCCACTTTCCGACTTTCCGAGCCATTTAAACAGCAACGTGGAGGATCGGAGGTCGGCTCGACATGTTTATGCACGT
AGCTCATTCCCCAAGTCGCGCAGACTCAATTTTTGAAGCAAGTGCAAAATGACCGAAGCAAATACGACAGTTGGGGGAGCGGCGCCGAACGCTTCGCCGA
TGGCTCTCTCTGTCTCGGCATCGACCTGGGCACCACCAACTCCTGTACACTCGATCCACCTCCTCCTCCTTCTCCTCCCTCAAGACTCCCATCTTCTAAC
GGTCTGTGCTCGCATTTTTAGGCGTCGGAATGTGGCACGTGGAGCGCAACCATGTCAAAATCCTGAAAAACCGCTCGGATCGAGGCCGCACGACGCCCTC
CGTGGTGCGATTCGACCCATCGAGTCAAGCCGCAGACGTGGGCAATGCCGCGGTTGCTTTGGAGACGTGCGAGCCGCTGGGGAACACGATCCGCTCCGTC
AAGAGGCTCATGGGGCAGAAATTCGACAGTAAAGCGGCGGACGTGGCCAGGATCTACGCCGGTTACAGAGTGTTGCCTACAGCCCAGGGGAACGTGGCTG
TGCAGGTGCTTAGAGGCGGCAAAAGGGACATTCAGGTGCAGCCGGAGGAAGTCTCGGCCTGTGTACTGATAGAGCTTAAAGCGTCGGCCGAAGCCTACTT
TGAAGACGGCAGGCGGCTAGAGAACGTGGTGATCACGGTGCCAGCGTACTTTAGCGACTCGCAGAGGAAGGCGACGATCACGAGCGCGTCCATGGCTGGG
TTCAAGGCTGTGAGGCTGCTGAACGAACCGACGGCAGCCGCCATGGCGTACGGACTGTTCTTGTCAGGCAGGAAGGTGGTGACGGTGTTTGACTTTGGGA
GGAACGCTGGACGTGTCGTTGTTAAGCATTGATGACGGCAAGTTTGAGGTGCTGGGAATTGGCGGAGATACCAACTTGGCGGAGAGGATATCAATAATAC
CCTATGTGACCACTTGCTGGAGGTGCTGTATAAGCATCATGATGTGACGAGAGCACAAGTGGGAGACGTGGATATGGTGAGGCTCAAACGCGAAGTGGAG
AAGGCCAAGATC