Description :
From Genome Similarity Track
Location :
Scaffold_191:45048- 47192
Sequence
2144 bases(100 bases per row)
TTTGCGAGGATTCTCTTCCTGATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTGACGGCCGGACTCTCGGAGCGCACAGAAGTCCTGGGACTGTGATCA
CCTTGATCACTAGCGAGCGACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCT
CGGACTCGGCATCGTCCTCACTGCCCGAGTTGAAGCCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGATGAGGGCGACGGACTGCGGCGCTT
GCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCCGAGCCTTTGCCGTGAGGCTTA
GTGCTCTTGGCTTGCGCCTTACCAGTAGCAGCCTTAAAGCGTGTCTTAGCACCGCTCTTAGCAATGCCACGAGGCTTGATTAACGGTCGAAGTGGAGACC
CAGAAGAAGAGCGCACAGACTGCTGCTCGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTCGACTTTGAGAATGA
GAGTTTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTA
CATGAAGTGTGACACTTCACACTTCAGGTGTATGACACGTGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAAC
CATTGGTCAAACGACATTGCATTTCTATAAATAACTTATAGTTTGTATTAAACCCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTA
TTTAGGTCACTTCGCTCTCTTTAAATAAAGAGGAGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGATGATAACTTCCTCTAGCGCAAGG
TGCTGTGTGACCCCGTCACAGAGCGCCTTAAATAAATGAATGCAGTTAGAAAAAAAATGTCTTGCTTTGGAGTATTAATTGTGACTAGTATTTTCTTGAT
CGTTAGGACAGCGTAATGAAACCTCATTTTGAAGTGACTACGTAGTAGGATTTAGTGATGGCATGGATAACTTCTTGTAATAAACACTGCCGTCTCGGAC
GTGCAAAAAGTGTAGTTTTATACTGTATTGGCGGTCGTAATACATGTATGTGGCAGCTCAATGAGGCAGCCAACAAAGTTCGACCTGCAACTTGATGCTT
AACCCTTCTAACCCGGTATTCTGTATCCTACAGAATAAAAGATTTTGCAGGATTTAGTATCCAGCTTACTTGGCTGCAGACTATGAATTCGCATATGATG
TTTTGTAAAGGGGGAGTTTGCACATCATTCCTATTGGATTGACGAAGGGAAGATAGACGGGGATTGTTCTACGTGAATAGAAAGAGCAATATAAATTCAG
TGGAGGTTTGAAAATTTGAGTGAAAGCCCAAAACGACCGCGTGTCAGCCACTCCCTCATCGCCGCACATTGAAATCTTTCTTCGAACGATGAACACCCCC
GGCGAGAAGACGTTCAAGCCGCTGTGGAGAGAATTATGCAAGGACGGGTGAAAGACTCGCAAGCCCACGCCCATGGCCAAGCATCACCGCTACGTAAGCC
TGGAATCACGGGCCGGTTGGACGAGTCACGACGCAGCATCGACTTTTTTAGGGTGCGTAATTAGACCTTGATATATGGTGCTACGTACTAACAGGATACG
TAATGTCTAGGTGAAGATGAACTCATGACATTTGGGCGTGCATCCGGCTGCCTCCAGCTTCCCCATTCAAGTGTGAGCATTGCATCTACACGCCGTCCGA
TCGGAAAGCAGGCTTCAAACGAAGCTATTGGTCGGCAGCTACCATACAGCGATTTACCAGAGGCTACGCAGCCCAAGCCACCTTCTGCGACCCCTACGAC
TGTGGTGTAGCGGGATCAGCAAAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN