Description :
From Genome Similarity Track
Location :
contig_13:4504- 8911
Transcript NameFunction/comments
g2938.t1hypothetical protein

Sequence
4407 bases(100 bases per row)
GCAGAGCCTCCTGCTTGTGATGAGAGCAGCTCTTCCACTGCCGGTGGCAAGTACTTAGCCCAGAGCTCCTCTGTGGGCTGGAGCATGTATGTCTCGCCCT
TGACGGCTCGCACGTGACCCGTCTTGCGTTCCCGCACATACACACCTTCGTTAGTGTCGAGTGGGATGGCGCGTCGGGTTTCGAGCACCTTCACCTGGAT
CGGTGGGATGTATTCACGAGGACCATGCACCATCCAGCGCTCTCCAGCTTCACGCCTGATGCCATTGGGTTTCTTGACAGGAGCGGCTCCACCGTCCTCG
CCTTCCGGCTCACCTTGCTGCTCGGGCAGCTCCACGAACGGCTCAACTGCCTGAAGCAGGACAGCTTCATCATCGGCTAGCACGCAGATGTCCTCGACAC
GCTCGTTTTCCAGTTGCTCACCGGGCTGCAAGAAGAAGCTCGCCTCTCCCTTCCGCATCTCGCGCGTGCCACGACGCGGGACTCCATTCACGATGGGGTC
CACCACGACGCAGTACTGGCGGTTCGTGAGGATCGTGACAGTGACGTATCCAACGATATCTTCATGTACATCTTGGACGTGTGTCTCGGTCGTCTCGGTC
GTGATCAGCCACTCTTCACCAGCGCGACGCGAGATGCCGTACACATCCTTGAACGTACGCAGCGCGCTCAAATGGAGAGCAGCGTCCTGGGTCAAAATGT
GGGCTTGAAGCGTTTCGACGAGCACCTCGTCGATCTGCGGCAGGTACGCGCCTGGAGTGCGCACGAGCCACTCCTCGCCAGCATCTCGTTCAATGCCCTG
CGAGTCCGTGCACTTCTTCTCTGCGCGAAATTTGATGGCCTCGTCCTTCTTGATCACGGACGCGTGCACGACGGCAACGATCTCCTCCTCGACGCGGGGG
TAGTACACCGCCGGCCCCACGAAGAGCCACTCGTTGCCTGCAGCATACTGGCCGATTTGGCGCAAAGCGCGGATGCGAAGCGCCGTATCCACGGGTACAA
CTCGAAGCTCGCGGATTTCTCCGACCTGCTTCTCGCCTGGGTACAACGGGAAGGGCTCTGGGTACTTGTCAAAGATGCGGAACTCGATCTCGCCGTGCTT
GAGCTTGGCCTGATCGAAGGCGTCATACTCGATCTTGCCGTCCTCGGAGCGCACCACGGGGTTGCGCACCTCAACGTAGTGCTGCGCCGGTAGCACGATC
ATGTCTTGCGGAGGCGTCAGGATGAATTCGTGGTCCTGACGTGTGAAGGTCAGCGGTCCCGCAAGAACGCGGGAAACATTCGAGTTGGTGTCCTGGACAT
GGACGTATTTGTATGGTCGGCAGGCGAATCACGCGAGGGCCGCCGTCGTTGCTGTTGCTGGCCATGCTGGGCATTAAGGGGCTTGGTGGATGACTGGAGC
TGGTGCTTGCGCTTGAAAATGCAGAAGTGAAAATGAGGTCTCTGCTGGAATCTGCGATGGTTTCAACCTGGGTTGAAGTGACATGGGTACATATCACCAG
CTGTGCAGGACGTCACAGTCCGTTGGGATACTCGATGCGGCATCTGTTGCTGCAGGTGCACCACGGTTGTCTCTGCGCTAGGGGGTAGCGCTCCGGTTCG
AGTCTTCCAGTGTCCTGCCCCAACCTTAATCCACTCGCTGCCGTTGCTGGCGTCTCCGTCAACCAGAGGGGTAGGAACTCGCGTCCCTACCGACACTTCA
GCCGATGGCCTTCTTGTCCCGGCTGCTAGGATTTTCTGCTGAGTCTTCAGTCTGCGAGACCTCTTTGTTGGCCTTTTAGTCTGAAGTGTTGGCTCAGCGA
CGTTAGTTTGAGTTGCTGTGGCCTCTTTCTCGACTTCTCGGTTTTCGCGCTCCATGACTGCAGCATGAGCAAACCGAATGCAACTTAGTGTCTGTTGAAA
ATAAAATCAACAAATACACACTGACCTAGCTTTCTCTCCAGCTCTTTCAAAATGACTGCATGCTGCTCGGAGGTGTCGCGTCTCGCAATGCTAGTACTGA
CCCCGCCGTAAAGCAGTCAATCATCGCTCTCTTCCTCTTCCATGATCGAAAAAAAAAATCACCAGGTATTTGTCATCTCGATCGCTATAAATGGTTGAGT
CGTAGTAAAAGCCTGCTTGGTATTTGGAAAATAAACAGAGCGAGTTTCAACACGAGCTAGTAGGGCATGGCGCCACGATTCTGCTGCAATCATGCTTCCT
CGCCATCCTGGAGAAAACAACGCATCGAAGTGGTTAGTACATTCATACTAGCATAGCAGCAGGTGAACCTGTCAACCATAAACGTACCTCGACGTCGTCG
TCACGGATTCTAATCCGCTCGCGCTTGATTGGTGGTTCGTTTCCGTTTTGGATACGCTTGAGTGAGTCGCTTCGCTCCCGCTTAATACCAGACGCCTCGC
GATCAGCATCCTTGTCACCCTTGTGCTCTTCTTTAGCATTTTCATCCCTGGGGGACGAGGTTGTTGCTTGTTGGGGGGTTGCGACTGAAGCTTCAGGGGT
TTCTTTTCTCACATCAGTGGTGTCCATGCCCAGGATACCCTTCACTAGCGTGCCTGTACCCTTGACCGCCAAGTCCAGATTTTTTACGCTCCCCTTCATT
GCTGCGCGCATTGTTCGCCAGCAGACCATCTCATCCTTGTCAGGCCAGTACTCTTCCTCAATGCCATTTTCAGGGTCCCACGCCTCCTTGAAGCGGTCCG
TGTATGCTGTCAAAGGAACCTCCGTGGCTACCGCACCAACAAAAACACAATTAATTAAGATATCTTGGTGAAAAGAGCATGAACGAACTCAAGATCGTTC
CAACACTCACCTCTTTCTTTGCCCTTAATCTTCTCCAAGATTTGCGATGGCTTCGAGCTTTCCAACAGAATTTGCTCCAGCAGAGGCGAGGTTAGCTGTC
GACGAGCTCGCTTCACGACGTGCTTAGGAGCAGATGAACCCCCCTTCTCCGCTGCAGCTGGATACTTCTCGTATTCCGGGCACTTCTCCTGCTTCCACTT
GACCCAGTTACGCTCGCGCTCGAGAACGTACGAAACCATTTCATTGAAACCCTCGCCATCAGATGGCGTTTGCTTCAGCAGCGCGACTACACGCTCAGTT
AGTTCGGCAAGCATTGCTTTCGGCGTCGTGCTGCCCATAGGTGGCTTTGCTCTTGCCAAGTCGTTGAACAGAATGAGAAACTGTGTCAGCATGCATTCCC
GGAGGATCGGGTCACGAAGCTGCAGTCTGAAAAGACGGCTGTTCGTCAGGTACTTCGGCTGGAAGAAGTGTTCCTGTGAGCCTTGCTCACTAGCATCCTT
GCTAGTATCACTTTCCGGCTCGTGTATCGTAATATCCGCCGAGTGAATGGCACCTCCACTGCTACCCAATAAGTCCCGCGACCGTTCCAGGTCATCCGGC
GAAAACGCATTTCCTTCAAAAGCGGCCAGGACCACATTCAGCTCAGTGAACTGAGTGCATCACACATCAACAGGAGGAATACGTTAGTCAAAGCATCAAA
GTTCACAAGGAAGCATGAAACGTACAAACTTTTCCCAGTTCTCCGCCGACTGGGTGGCCATCTGATGCTCACGGAAGAAGCTTTGCAAATCCCAAAAAGT
GCGATAGAGGTTGTAGTCGATGGGGCCCACGTCGGCGCTAGGATCGCTATCAATCTGCACAATTCAGCACCACCATAAGTACGTGCAGATCTAAATCCAC
CCAAAGGGAAAATATATCGCAATTCCCACCTCCAGCCCAGGAACAACTTCCGAAGCCTTAGCAACGTCTGTAGCCTCAGCCAAGTCGAACGCATCTTGTT
CTTCGAACACCGTCACATTGGTCACATTTGACTTGCCCGTCAGATTCACAGCCGAGCGCTCAGACAGCGCGAAAGTGAACGACAAGAACACCAAGATCTT
GCCGCAGAACACGCTATTGTGCGTTTTCGACAGGCGACGCAGCAGGGCGTTGCACATCCGCAGCAGACACAGCGACGCCTTGGTCGTGCGGCCCTTCTCC
GCGATGAACTCCGGCTGCTCGAGCAACAATTCACGCGTCAGTTCCTCTTGAGCTCCAGCAACTACGACTCTAAGCAACCCACCGTCGTGAGCTTATCCTT
TCGGGACTCCAGCAGGTCCCACACTTTCTCGCACGTGTTGATGGTCTGGCCCTCCATCAGATCCTCCAGCACCTTGTAGGGCGTGCTGTTGATCAGGAAC
TTTCTGGTCACGCCGGAGATGCACAAGTCCAGCAGCGCCGGGACGCCCACGCTGCTGGGCGTGGCGTGAGACTCCGTCATGAGCTTCCACGAGAGCTTCT
CCACCACCTTTTGCACCGCCAGATCCAGCACATTGTGTGTGAACTCCTGTGGCCGCGGGGTCTTGAGCTCCTCCACGACACCCAGCGTGCGGCTGTACAG
CCGGTCC