Description :
From Genome Similarity Track
Location :
Scaffold_682:4504- 8122
Sequence
3618 bases(100 bases per row)
CTGGGCGGCTGGCACTGTGTCGTAGCAACACCCACCTCGCCGTAATTTGCCTCGAGAATGGACACCACCTCCGGGTTCTAAACCGGAGATCGAATATGTA
GACGCGGACGAATTTCAACGCAATCTCAGGACCGGGATGTAACGGATTTTCCCGAATACAAGACCTGTAGGAAATAGAAGTCCGGTCAGGAATTGGTTGG
AGTGCCTGAAAATAGAAGTCATGTATCAAATAAAAGACCGGACATTTATTTTTTTAACCCTTTCGTGAGCAAGTCACTAAGTATACTATACAAACTCAAG
GTACTTGAAAATCAAAGGGGGCATTCTGCTCCGTTCGAGCATGTAGCCATCCCTGCCTCTTGTTGGGTACACAAATGGAACAGGGCAAAATGCCCCCAAC
GGGCAGGACAAACCTTGCGTCTTGATAGGCCAAAACAAAATCTTTATGGAGGGTCGCCTCGCTGAAAGGGCGCAAGCCTCACGCGATTGACTGGGGTTGC
AGAGGAAGCGGCACCTTGCTTCGACGGAAGCTGATCTGGAAAGAGTTGGACTACGAATATCTTCGCTATATCTTACGAGGGATGCGCTTGTTTGAAAGTA
TCCGAAGGTGTCGTCGTAGGTAGTGCCCCGCGCGCAGTTTTGAAATTCGCGGCTTCGAGTTCACTTTCCATTTTGCGAGCCGCTACCCAGCTCCGTCAAC
AAACCTCGCCGACAAGAGGTATGCTGCTGGACCCCGCCACGGACGCCACGCTCGCCGACGGCTAGGGTGGCATGCTGCGGCCCGCCACGCTGACGGCACG
GAGAGCATGCTGCCGAACCCCGACACGGACGCCACGCTCGACGCCAGCACGGACGGCATGCTGCCGGACCCGACGTGGACGCCAGCACTGTCGGCACGCT
GCCAGACCCCGGCGTTGACGCCACGCTGGACAACTGCACTGTCGGCACACTGCCGGACCCGACGTGGACGCCACGCTGGACAACTGCACTGTCGGCACCC
TGCTGGACCCGACGTGGACGCCACGCTGGACAACTGCACTGTCGGCATGCTACCGGACCCCGACACGGACGCCACGGCAGACGACTGAACGGAGGGCATG
CTGCCGGACCCCGACAAGGACGCCACGCTCGACGGCACGATGGCGGAACCCGGCGTGGACGCCACGCGCGACCACGGCATGGTCGGCGCGTTTGTGTGCC
CCGACGTGGATGCCACGCTCGGTCGGCACGCTGGGAGGGTATGATGCCGGACCCTGACCTGGACGCCATGCTCGGAGCTGGCAAGGTGGGCACGCTGATC
GGACGCCACGGTTGACGACCGCAAGGGGGGCTTGATGCCGAACCTAGATACAGACGCCACGCTCGACGTTAGCATCGCCAACATCGTGCTTCAGCAATGG
CGACATGGTGCTTCACTCTTACCAACATGCTTTGGGTCGTGAGAGTGGTAGATTTACTATTGAGCGCAATGGTATTAGGCAAAAATCTGGTAAATGTGAA
TGAAAATGATACGTAGAAGTTTGGATCGTACAAATATTGCTTGCTTGGCACCAGTTCTCTACTGAGTGCCCCCATTGAAGTACATGTATATTCATAGTAT
CCGACGTCGGCACCGTTTCCCACCATGACGCAACACAGCAGTGTTAGTGTACATGACCGAGTGATGTTCAGCAGAAATTCAAGCTTTACAGCACAAATAG
TAGTAGATTTGATATTATATGGATAGGTCATGCCCTGAAAATATCGGCTTGGAGCATGCCCACACGAGCTGCGTGAAGACATGCAAGCTTAGCGGGAGTT
GTACCGTCGGATGGACGGATCGTTGTCGACGTTTGCACAGGCTTGAGCGGCGCAGGAGGTATATCCCCTAACAGGTCAGGTTCGTTCAGTCGATCTCCAA
CGTACGGGCGTTCAGCTCATCGCAGCTGTTGACCAACCGTAGTCCACACTGAGTAGCGTAGACTTCAGGATAAGGGCTCGCTCAAGTTCATCAATGTTAC
CAATAGAGCCTGACACGGCAACATCGTGGCCTTCGGTCGCCCCACCTGGCAGAAAGCTTGGACATGTACAACAAGCGCCTTTTACTTGTTTTACATGTAC
CCACTACAACGTGCATGCCAACCTGGCGATCTTTGCGTCGTCCAATCACATGACGGTCTACAGTTCCGCCAATCACGCGCGCACCACGCAGGATTCCGCC
AATTACGCGACGGCAATGCAGATCTCCGCCAATCACAACACGAAAAAGCCGAAAAAGCGAGCCCAAAGGAAAATAGCCTGGGCTCAGCTTGGCGCATCCT
ACTTTAACTTCAACACCAATTAGTACCCGGTCTCGGGGCTCTAGTACTACACGTACTCGTCCTCGGTCTCGGGGCTCTAGTACTGCATGTACTCGGTGTC
TGTCTCGGGCCTCTAGTAGTTGATGTACTCCATGTCTACCTGCAGCTACCGACTGCATCAGATTTGATGCACCAGATTTGTGGTACTTATTGGTAATGTC
ACGGGTCCCTAGTACTTTTGTCTCGTGGCTTTAGCATTTCCCGGCACGTCATGGCCCGCGTCTTGGAGTTAGGCATGAGGAGGGCGCCGCCCTTGGGTTC
GCGCCAGTGGGCTGGCGCCAGCAAGGTCACTCAAGAAGCGGGCGAACATGTCGCGACCGAGGTATGAAGCATGAAGATGCCCAGCGGGCTGCGGCAGTGA
GCACAGCGCTCTTGAAGGCCTTGAGAAGCAGTGAAGGCATGGCTGCGGGGGCCAGGGCGAGTAGGGCCGCGGGGGCCAGCGCAGTGGTGGCGCGGCAAGA
CGTGTGGTGTGATGTCACTAAAGTAAATTTGTAAATAGTGACACCCGAGAAGCTGCTGTTACCGACCAGTTGCTAATACACATGTACCGACTGTCGATAC
ATAGACCTCTTGCCTCAAGACGCCGATAGTAGCTCGAGTGTACGCGGCCGTGGATGTACGCGTCTCGGAGATGTCTGCTCTTAGCTTAGTGCCTCCCACA
TCGAGGAACGCATCCTACAGTACTGCTCGATGATCATGAGCAACAGGATATTCATGCTATGACGGAGTTATGTCGTCGTCGTAAGGTATACAAATGTTCA
TGGGTAGTTAGTTCATCATGATTAAGCTTAGCGGTTTGCGCTGGTGCGATGATTATTACATTGGCTTGGCCAGTCAGGACCCCTGATCAAAGGAAAATTC
TGTTCACCAGGCCAGTATAGATTACGTGCAGTCACCGCAGATTTGGCCTTGCGTGTTTAATAGAGGCTAGTCAGGAAACCTTGCAAGGAAGGAGAAAACC
TGTTCACCGTTGGTAAGTGTGCTGCAGAATATCACGTTGCAATGAGTGGCTATTCAGGAAACCTAATGAGGATAAAACCTGTTCACCTTAAAATTGTTGG
CAGTATTAGCGTTGCATTCTTTTGATTTAGCAGATAACGTTACTGTTGGTTTGCAGTAGTTTAGCTTTGCTTTTGGTGATGCAGTTGGAATTCATTGCAG
TATCATGACTACTCAGGAAAATCTAAACTAGGAAAAACCTGTTCGCCGTTCAAGGACATCGTACTCATAAGATAACCATGAAGGTTGAGGAGGTTGTCGT
CTCACCCGCATATTATGG