Description :
From Genome Similarity Track
Location :
Scaffold_448:4504- 6023
Transcript NameFunction/comments
Phypl_g8425hypothetical protein PHYSODRAFT_346079

Sequence
1519 bases(100 bases per row)
CGAGTTGTCCAAGGCTTGGGCTCCAAGCGCGCCTTGAACTGGTTCGCAGTATGGTTTGCCCAGCACTGCATAGAGACTGCTGTTGGTCCCATCCTAATGC
GAAATCTCGCTTGTCGTTCAGCGTTTTTGAGCATTGCTGCCGTAGGAGTCAGTCCGCGTTTAACCGAACccagcacacacacacactaCCAAGCCACCAA
CTCCAGCAATAATGAACTTCAAGACCTGCTTCGCCATTGCcctcgccgctgtcgtcgcaaCCGTCGTCAGCGCGGAGGACCCGCTGTACTGCCAGGCCAC
GGGGTGCCCGACCCTCTACTCCGAAGCAAACCTTGCGGTGAGCAAGGACTGCCGTGACGAGGGCCTCACCGGCGATGCCTTCCACGGGTGCTGCGAGAAG
AAGTGTGGCGCGACCCAGTAAACGCTCGCGCAAACGTAGACGACTCAGCCGCCGCATCAGTTCTGCAGCATAGATGTTTTGCTCAAAGCAAGGTGGAGCA
CGGGTGACAGCCGAAGGCCTCTGACGGTGAATGAGCTCAAATGCAAGGAATCCGTTTTATTTTTTCATGAAGTTTTGCTCATTTCCGTCTGCCGCACACG
ATGCACAAGTACAACAGTATTTCCTTGTTTAGGGAGCTAAGATTTTCGGAATTCTACAGGATGCCACGCGTTCGAGGGGCCAGGAAACTCGGTTTTCCCG
AGGCTTCTGAGCTCGATCACTGTGCCCCCATCCAATCGTCAGACTCAACACTTGAAGGCCTAGTTCAAACAGACGTGTTGGGAGCTCGATACAGACGTGT
TTCCCTTCGAGGACAATGACCCCTGCCGAGTACTACACGTAGCATTGCTGGCCCACGTGGTGGAAGAGCCTCAGCGCTGCACGAATTTTGCCTAAGCTTA
CAGTTAAACGCTCACCCAATGCTGTACGGAGATGGTTCTTCCGCCGATACCAGTAGGCACTTTTTACACGAAGACGTCAAGGCTCGTTGACCCGATTTCT
GTATCATGCATTTCGTTAGAAGCCCCAGAGACGGAATGCAAACACTttcgacgtcgacggtgACGGAACAGACCTACGCAACGTCACAGACCGCTACTGT
CCTCTACGCGCGGACCCTCATAGCTAGTCAAGCAGTTCGCCCGCCATGGCACCGACTTGGACCAGTCTCTCCTTTCCCAGTGACTACAGGAACAACGATG
TTTCTGCTAGGCTATTATAGCAGACACATTGCTGACCCCGTCGCCGCCTTTAGCGAAGATGGACGACGCCCATCGGGAAGCACCGCAGCCTCCAGGTGTT
TTGACCGAAGGTGGCCGTTTGGATGAAGCTCATGGTCTCACCTCTTCCCAACTTGGAAAGGAAGGACGAAATCCGTGCGGCACCCTCGTAACGCCCTAAA
GCCCGCGTAAGGCACCTCACGCAGTCTTTCGTAGCGCCGACAGAGGAGTTTCGGTGCACCACGGCGAGTGTCCGTCGCGCCAGCATTACCAGCGACCGTC
GCGGGGCTCTCAGATGGAT