Description :
From Genome Similarity Track
Location :
Scaffold_27:450368- 451497
Transcript NameFunction/comments
Phypa_INRA-310PPTG_11623hypothetical protein
Phypa_INRA-310PPTG_11624hypothetical protein

Sequence
1129 bases(100 bases per row)
GAAGAAAAGCAGGAGACATCTGAGAGTGAAGAGGAAGGGGATCCTGATGATGACTCGAGGTGGTGGGAGTCTAGCGAGGATAAATACAAATGGGAGAAGC
ACTACAAACAGGCCGATGCCGCCTTCCGTAAGAGATTCGGCTGTGGCATTGACACACCAACGCACCCGGAGACAAGGAGGAAGTTGAAGAAGAAAAAGCC
AAGATATCAAGCGTACAAATACTTACTAGCAGGCTTGGTGATCGTGAATCTGGTGCAACTAGCACTGGTGTATTCGGCTTCATCATGGGCGTTTTCAATG
GTAACATGGCGACCGTGGACTGCTGACGACAACGTTGGCAGTGGCGAAGACCACAGACTTGTAGATACGCCAAGCAGCGAACATGTCGTCGATGTATTAG
CTCCATTTACGCAGCAGCAGGTCCCAGAGCACGTGCGGACTGGTTTGTACTTATGCTCGTCACTCTCTCGGCGTGTAGTCAAGTCTGAACACGACGTGAC
AGCTACACAACACGCACTACGCGCATGTGATATCGCTGTCAAATTTGCACCGCTAGAATCACGTGAGGCAATTGAGGCCCACGTGCTTCGTGGGGATCTG
CGTAGTTTACTCTCGCTCTTTGACGGCGCTGATGAAGATTACAACTCTGCTAAGGATTTGATGCTGGAGTCTAACATGGACTTAAAACTTGCACGGGTAT
TAACGCAGGACCTGGAACTGAAGCTGATTGCCAACCGCTGGACGCAATTGTACAAAACGAAGAGTTTCAAGGAATTGCGACGTGAGGCCAAAGCTCGAGT
TACACAACTAAACAACTCGGCAGATGCGGTGAGCGCGCTGGCGGCAGACTGGTTAAGCGCATTCAAACGCAAGAAGCCAGTGCTGGACGTGCTTACTGCT
CAGCGTGGCTGGACGCTACGTCGTCTCAAGTACGAAGCTTGGGATAATGACGAGAGAATACCTGACAAAAGGTGAACATGGGGTCGCTTCGTACTGCTTT
TTAATCTATTCTGCAACCAACATTTATTCATCTTCTTCATCGCTCTCCTCTTCACTGCTTTCCTCGTCCTTTTGTTCTTCATCTTTGGATTTCTGCAGTT
CTACAGTCTTCGCCTTCAGTTCACGCACT