Description :
From Genome Similarity Track
Location :
Scaffold_448:4503- 5909
Transcript NameFunction/comments
Phypl_g8425hypothetical protein PHYSODRAFT_346079

Sequence
1406 bases(100 bases per row)
CCGAGTTGTCCAAGGCTTGGGCTCCAAGCGCGCCTTGAACTGGTTCGCAGTATGGTTTGCCCAGCACTGCATAGAGACTGCTGTTGGTCCCATCCTAATG
CGAAATCTCGCTTGTCGTTCAGCGTTTTTGAGCATTGCTGCCGTAGGAGTCAGTCCGCGTTTAACCGAACccagcacacacacacactaCCAAGCCACCA
ACTCCAGCAATAATGAACTTCAAGACCTGCTTCGCCATTGCcctcgccgctgtcgtcgcaaCCGTCGTCAGCGCGGAGGACCCGCTGTACTGCCAGGCCA
CGGGGTGCCCGACCCTCTACTCCGAAGCAAACCTTGCGGTGAGCAAGGACTGCCGTGACGAGGGCCTCACCGGCGATGCCTTCCACGGGTGCTGCGAGAA
GAAGTGTGGCGCGACCCAGTAAACGCTCGCGCAAACGTAGACGACTCAGCCGCCGCATCAGTTCTGCAGCATAGATGTTTTGCTCAAAGCAAGGTGGAGC
ACGGGTGACAGCCGAAGGCCTCTGACGGTGAATGAGCTCAAATGCAAGGAATCCGTTTTATTTTTTCATGAAGTTTTGCTCATTTCCGTCTGCCGCACAC
GATGCACAAGTACAACAGTATTTCCTTGTTTAGGGAGCTAAGATTTTCGGAATTCTACAGGATGCCACGCGTTCGAGGGGCCAGGAAACTCGGTTTTCCC
GAGGCTTCTGAGCTCGATCACTGTGCCCCCATCCAATCGTCAGACTCAACACTTGAAGGCCTAGTTCAAACAGACGTGTTGGGAGCTCGATACAGACGTG
TTTCCCTTCGAGGACAATGACCCCTGCCGAGTACTACACGTAGCATTGCTGGCCCACGTGGTGGAAGAGCCTCAGCGCTGCACGAATTTTGCCTAAGCTT
ACAGTTAAACGCTCACCCAATGCTGTACGGAGATGGTTCTTCCGCCGATACCAGTAGGCACTTTTTACACGAAGACGTCAAGGCTCGTTGACCCGATTTC
TGTATCATGCATTTCGTTAGAAGCCCCAGAGACGGAATGCAAACACTttcgacgtcgacggtgACGGAACAGACCTACGCAACGTCACAGACCGCTACTG
TCCTCTACGCGCGGACCCTCATAGCTAGTCAAGCAGTTCGCCCGCCATGGCACCGACTTGGACCAGTCTCTCCTTTCCCAGTGACTACAGGAACAACGAT
GTTTCTGCTAGGCTATTATAGCAGACACATTGCTGACCCCGTCGCCGCCTTTAGCGAAGATGGACGACGCCCATCGGGAAGCACCGCAGCCTCCAGGTGT
TTTGACCGAAGGTGGCCGTTTGGATGAAGCTCATGGTCTCACCTCTTCCCAACTTGGAAAGGAAGGACGAAATCCGTGCGGCACCCTCGTAACGCCCTAA
AGCCCG