Description :
From Genome Similarity Track
Location :
Scaffold_503:45026- 46847
Sequence
1821 bases(100 bases per row)
ACCCTAGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGA
AGGTCTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTAGACCTGGATGCAAGGTATGACCTCATCCTTGGCATG
GCATGGCTGGAACGTCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTTCTCCTAGTGGAGCTTTGGTGAGTCATGAACTCA
TTTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGGGGCCGAGGCGGCCGTAGTACTGGACATAGGTATGTCCGAAATTGTTAGCAACGAGGTTGC
TGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCTGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTACTGGTGAGGAAGAGCGCGGA
GTGGCGCGTAATCCACTGAGTGGTACAAATCTGGTCGATGACCTACCGCTGCGTGACCCGAGGGCCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTG
GCCCAGAAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGGTCAAGGACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCGCTTC
GAGGAGTGATGGTGCTGCTGCACCCGGCGGTGGTGACGGAGATGTCGCCACACCGCCCTCTTCCGGCCGGGCTCGGTCGCGGAGGAAAAGAAGAAGAAGA
CGCAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCACAAGACGAGCCGAGCGGTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTC
GTGAACGGACTCACGGGGGAGGTAGAAGGCGATAGCAGCCTTGGTACTCTGCCCGCTACAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGT
TTGGCGAAGCCTTAAAGGCAGGCGAGCTGGTCTTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGAACGCCGCGGTCCTAGAGGACACCAA
GACGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTTTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCAAAAGAC
CCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAG
AGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAG
AAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAG
AACAACATGGTAGGCTGTACGCTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGA
GTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGTTGTTTAGGCC
CCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGA
GCGGTGCTCGAGTGCATGAGC