Description :
From Genome Similarity Track
Location :
scaffold_159:4501- 7562
Transcript NameFunction/comments
Pl_108558hypothetical protein PHYSODRAFT_510120

Sequence
3061 bases(100 bases per row)
AGGTCATCTCTCGACCCCACCGCCTTCCATCGCGCGTCGTCCACTACGCCGCCATTAGCGTACGTGTGACGGCCAAACTCCTGTACGGTGTGCTGTAACA
TGCACGTGACCATGCGTTTAAGTGCTCGCTGCTCGAGTCGTGACAACGAAACCTTGGGTAGTTGAACGCGTGCGATAGGAAAGCTCGCGTTTGAATTCAT
GGTGTTGTTTCTGCTTGCCGGCGAGTCCGCGACTGAGGAACGGACAACAATGGAGACCCAGACACGTCCTTGCGACTTTGAGGGGGTCTCGCCAGAAGGA
CCACGCACTTGAATTCGTGGGATGGAGAAGTGACACACGATTCAAGACAAAGGCGCCGAGATGACCATCACCGGACGGCTTTGTACGCTACGATCATGCA
GGAAATCTGCTTGTAAATGCATTGGTGAACCAGTACTTGCTGCATCGGCTTCTGTACGCTTTCTACAGGACTTGACGTCGAAGTTAGTGGTCGATCTCAC
TAATGTATCCAAGCGCTAGGATCACCCGTTGCAGACGAGCATCGAGTCATGGTCAAATCTCGTTGGATAGCCTCTTGAGGAAGGCGTCCTGGTTGAAGTG
ACCCTCTTGACCAGGTCGATGCAAGACATCATGCCAACAGATCAGCAGCAACGGATACCACAGCAAAGTCTCAGTAACCTGCACAAGTGTGTATATTGAC
GCCTTAGCGTACGAGACTGCAACAACAAGGCGTAATTGGATGGAGTACTCCTCTACTACGAGTCAGCATTTAGACAGCTACAGCTTCAACATCAGCCGTC
AGAGTCGGTCCCCGAGTGGGTTGCGCGGTACTTGGTTATAGTGTCGCTCGTAGAGTCCGTACACGATTCCAGGCACGACGAACGCCAAGACGATGAGCGT
CGACGTCATGCTGCGGAACGTGTCGAACACAATGTAGCAGAGCACAATCGTCGGCAGTCCAGCAATTGCAGCCAGCACGCGAGTGCCACCTGGGACTCGA
ACGGGTCGAGGAATGTATGGTAGCAGTTGGCGTAGTCGAATTGAGGCGAGGATGATCAAAACCTGCACAGCCCCAGCGAACGCATTGGCCATGGGCAACA
GATTGTCGAAGTCAACACCTAGCAGTGCCATCGTGAACAGTGCCGTGGTGCCGATAGACACGTACGGAGCGTCGAAGCGCGTGCTACGCCATGCAAAACA
GTTAGGCAGGAGCTGCACGTCACTCATGCCTGACAACTGGAACGACTTGCAGAAGATACCAGAGACGAACAATCCTGCGACGGAGCAGCACGACGAAAAG
ATGAAGAACGCCTTGAGCACGGAGCCTCCAATGGCGTCGGCGAGCGCAGGGTACGAGTCATGCGTGAAGTAGGTCCAGTTATGGTCATCAACGAGGATGG
CAGCAGGCATTGGCACTAAGTACGTCAGCAACGTCAACGCCACAGTGAACGCGATCGCTCTTGGATAAACTCGTGCCGGGTTGGACACTTCACCACCGAA
AACCGAGGCCATGTTGATTCCGTCGAAAGCCCAGAACAGGGTGTTCAACAGCAAAGCTAAATCAATATCCACACTACCCACTTGCTCGTCGTCGCCCAAG
TCCTTGTGGATAACGTTGATCTCTCGTCGAATCTCAAATAAATCTCCGAAGTCCCGCGCACGGGTGTATCCCCAAACAGTGAACACCAGGACAGGTAATA
GTACCCAGACCAACAGAACGATGCAAGTCCGAGACACCACTCGAGTGCCTACCAGACAAGGGAGCGTGAAAACAATTGCAAGTGTAAGTTTGACGGCGTA
CGAAACGATGCCCGAAGAGATGGAGACGCCATAGTAGTCGTTTAAGATTTCCAACAAGTAGCCCGGCAACAAAGCTGTATTGAAAATGCCCGCAATCCAA
GACCAATAGCCGACCTGGAAGCCCCAGAACGAACCAAAAGCATTGAAAACCCACACTGTGAATCCCCCGTCTTCGGGAAATGCACAGCACAGCTCCGCTA
CGATGAAGGCGTACGGCCCAGTTACAAGAAGGGGATAAAGCAGCATAGCTGGAAGACCGATCACTGGACCTGCGGACGAGATAATGGGCTCAGATCCCCA
TGGGCCACCGCATCCGAAGAAGTACGTCACGGCCACAATGGAGAGCGTGCCCATGACGCGGTGGCGAATCGGGGTCCCATTTGACTTCCTGTACGCGCCA
TCGGCATCCAGTACCGCCGTGTCCAGGCACTCGATATCACTACAACAAGAAGCAGTCTATGAGTACAATCCATTCGGAAGCAAAAGGCATGTCAACTCAC
ACAAACCCGGCAGTCATAGTCGTCATGTCGGGGCAAATTTCCTTGTGAAGGTTGGGATCGGCTGACCATTTTTCCACAGACACGCTGGTGCTTTCCACGT
TTCTCCGGCTTTGATCCGTCCTGCTCACCCGTTTCGTTAGGCATATACTAATAACGAACGGGGAAGCAAGACCACAGACCATGTGAACGCTTCACCGCAA
TGCATACTTCGCGAATCATGAACGTACGCCAATATGAACGCTTGAAAACTCAAGAGCCAGACTCCCCGTCCGTGTTGCTGCTTTCAAGAAGCGGCTAGAC
GAGCATATCGACTGCAACAACCAAAGCAGACGTGTACTACGAAGTAACTTATCCACCAGACATTTTGATTGTCAAACTAGGTTTGAGCCCGATCGCTTCT
GTAGATTTCTCGTTAGGGAAGACTGCCATAGGGAACACCATCAACGACACCATTCAATGATGATGCGATAAAACCACCAACTCGACGGAAATTTGCATCC
ACAGATCGAGTGAGAGCCCTGGGCAGAATGAAATGTTCATCCGTTGGGCTGGATAGCTCCGATGGCCAACCATTACCGAAGAAGCCACGGCCGTGATGGA
GACGCGATAATGAATGACTAGCGGTTTGGATGAAGGTCTAGCACGACGCGTGCGCAAGCTGCATCTTAAGCACACACGTGCAGGGTTAGTAGCCACCAAA
ACCAATGTGTTTCCAAGGAAGCATCTTGATTCATTTACACTTCCAGAGCCACTCGATGTGT