Description :
From Genome Similarity Track
Location :
scaffold_1045:4501- 6256
Sequence
1755 bases(100 bases per row)
TCGCTCTTCAAGAGGAGTACAGCCATCGACAGACTCGTACTCCAGCTAAAGCCACAACGCACCGACGAGTGCGGCACAAGGGGCTCTGAGAAACGGAACC
AACACGGCGTCGGTTCCCGTTGAACTGGGTACGGCCAAGCAGAGCTCCGTCCGCTGCTACGGATGCGGCAAACTCGGGCATATGCAATGCGCCTGCCCTG
TGGGAAGATCAAAGGACGCTCAGTCCCAAACCGAAGGGCTCGAAAGCCGCCACCGGCAAAAGCCGTGGCCCAAGAGCCAGGGGATCGGGCTACCAGTAGG
GGTTGAGTGTCCTAATGGGGACGATCGAAGTCTTCGGGGAAGACGTGCGGACGGCGCACATCCCGGAGGCTTAGTCCCAGAGAGTCTCAATGCTCTCGAA
TCAAGAAGGAGCAGCGGTAGACTGCTGGTGGTATACGGGGATACGATCACCCCTTCCGAATCCTGATTGATTCAGGCGCGTCGAAGAACTTCGCACGCCG
ATAATCGGTCGCTCGGAACAGCAACAAGTTTGCGGACGCTCTGCGTGAGAGCGAAGAGAAGGACCAGGTCTCGGTGAGACTGGGCGGCGGTAAGGTGGTA
GAAGTACCTCGGGTTCACATGGACCTAGCTGTAAAGCTCGAAAACTTTGACAGTTCAGAGGAGTTCCTTGTCCTAGAGACGGACAAGTACGATCTGATTC
TAGGAATGCCGTGGCTAGAAAAGCACGAGCCCCGGATAGACTGGCGCGGCAAAGCTATTGGGGCTAGCCGGTCTGCAGTTCCCGACAGAGCATTGGTGAG
TCATGTTCCCACCTCTGTCCGAAACCGGGGCGCCTACGGGGGTCACCACGACGCGTCAGCGTTTGAAGAATTAATTAGGGTCGCTGACCCCGCTGAAGAA
GTTGCAGTGGGTGCTGCAACAGGTCAACATACCTAGGTCCAAAGCAGGGCATGTGTGACTACAACGTCAGTAGCTCCGAACACTGGAAGTCGTCACGCCG
TATGGCTGGGTAACATACTTCCGTATGCAGCAGAGGTTGCTGAGGGGAGCGATAAGAGCATCTCCGACGTGGGCAATAAAATTCCACGTGAGGTCGAAGA
GGCCGTCGAAGTAGAAGAGAACTATTGTGTCTCTTACGTAGGTAACGCAGATCCACGCGGGGCTGAGAAGGCCATTCTGAGGGAGGAGGTACCTCCCGTG
TGGATAGCCAATAGCCACACTCGGGGTCGGAGACCACTGACCCACAGCCGGTTGAAGAACAGTACCATGCCTTCGATGACGAGACCGGTTGTCGGGTCAA
GACACGCGCCGTCCGTCTAGAGTCACTGTCTGATGTACTAGCTTTGCTGAATCTAGAAGAACTGTCCATACTTTCTGGCGGAGTTGAAGGCCGGAGGAAT
TGAGGCGATGGTACTCCAAAGCCGGAGACCAATCCTCTGGAATTGAACTCTTCTTCCGTCATGAACGAGAATGTCCTGGAAGGGGTACAAAGCAGCGCGC
GACGCGCTTGGGTTCTGAGATCCTCAAGAATCCGAAGGATATTTTAGTAAAGGAGGTCTTGGATATGGTGCCCATCCAACTCGCGCCGGATCGAGGTGTC
CAACACGAGGTTGACGTAATGCCTGGTACGAAGTCCTGTGTTACCAGACAGTGGCCTCTACCCCGCAAATAGTGCAAGGTAATTAATGCCTCCTTCGCAG
AGAAAGTGAAGGCAGGCATGGAGCGGGGTCGAAGCCCCCGCACTCGACACCAACC