Description :
From Genome Similarity Track
Location :
Scaffold_125:45000- 46564
Transcript NameFunction/comments
Phyta_totarag4127hypothetical protein PHYSODRAFT_345492

Sequence
1564 bases(100 bases per row)
cttcttgcgcttctcgcgctTCCGACGCTTGCGGTTCTCCTTTTGAGTGGCAGACAGCACCTTGCGCTTCTTACCAGCATGGGAAGGCTCAGCTTCTGta
gtcgaagaagttgatgctACGTCAACACTTGCAGCAGTCGGTGCTCCGGTTGTCTTCTCGGATTCCTCATTCACTGCAGtagcagcgccaccaacacgGT
CAGCTCGTTCGAAATACGCCACGAAGAATCCGTTTGTCGAATCCTCGAGGCCGTTCGCACGCACGAGTGCCTTGGCCTGCTCAACCGACAGGCCTGCAAC
CTCAAGACCACGTCGTGGCCATGACGTTAGGGCGGGCTTCAGCACAAAAGGACGCGCTGCGCGAATATTTTCCTCGGATTTCAACGCTGCACTGAcaact
tcctcgtcttccttctgGAAAATAGAGCAGGTTGAATACACCACGCGCTCTACCTGCGGAAATGAAAACGCCTTTCGTAATGCTTCAAGCTGAAAGTCTG
CGAGCGACTGCAGGCGCTTGGCTGTGTCTTGCTCGTACTCTGCACCGTGATCGGGCTCCAGCACGGTGTCACGCGCACTCGCAATGTCTAGCAAGTGATC
CAGACGATTTGTCATTCCCGAACCAGAGCAAGACGGGTCAAGCAGAATACTGCGCACATTGCGAtacatctcgtcgtccacgggGACTTCCAGGAAGCTC
TGTAGTTCAGTCTGTACACGAGTGGCAGCCCCTGCAAGCTGCATACGTCgcttcagcaactcaagTCGCTTGGGCGATCGGTCGAATGCAAACACTCGTC
GCTTCGGGGTAGTGCCGTCCTCTGCATTGCTatcctgttgctgcagcagcatcgccaggTGACTCGTCTTGTTGCCAGGCGCCGCACACGCGTCGATCAC
ATCGCCCTGTTTGTCCTTCGCATCCGCGTGCTCTCCATGCAGCACGAAAGCCGGGAAGCAACTGGccttgtcctgcagcaccatcttTCCGCTCTTGACC
ATCTcgtgctcgtgcagctccgtGCCCGACGGCAGCACGAGCAGATCTCGCACGTCTCGGTCTTGTTTGGCGTCGTACTCGCGCGTGAAggcctccgcct
cctcgggagaagccagcagcgtgttgacACGCACGTACCGAGGCAgcgcgaggtgctgctggcggttCTCGGGCGGCAGAAGCGCCTCGTTGGACGCCAC
TTtgcgcttgatcttgagTCTCGCAAGCGCCGCGCGGAACGACGTCTGGTGCTGCACGAGTGCCTTTTTCACGTAGCCGCCGCCCTGGATCTTCTGCCGA
CCGAAGAGCAGGTCGTAGAGCGCCACGAACACGAGCGCAGGCGGCTCCTTGGCGTCCTTGGgcgtcttgagcgccttGTGGCACTCAGGCacggccgcca
gcagctcgcgtaGTAGCGGCTTGTAGCGCAGCGTCTCGCACACGAGTGCGAAGGAGCTGCGCTTGTGCACTGTGGACTCCGCATACGCCAAGCTCTTGAG
TCCGCCctgacgcagctccagcttgtgcagcagcgccgccgcctccttgTAGAGCTCGCTCATG