Description :
From Genome Similarity Track
Location :
scaffold_298:4500- 6931
Transcript NameFunction/comments
g6978.t1 putative polyprotein

Sequence
2431 bases(100 bases per row)
GGGTCTCGATCCGAGACAATCGACTCAGGGAGTCCATGTTGCCGGAAGACACGGTCCATAAAGACTGTCGCAGTCGCTTTACCATCGATGGTATCCGGCA
CTGCCGCCATGTGAGCCATCTTCTCAGCCGGTCAACAAAGACCACCACACCCGTGTTGCCATCCGAGTCCTTCGGAAGGCCAAACACGAAGTCCATGCTC
ATGGATTGCCACAGCCCCGAGGGCACAGGCAGGCTCGCCAGCGGCGCCGCCGCATGCGGGGATGGCTTCACCCGCTGACACGTCTCACACGAGCGCACGT
ATGTGCTCGCCCATTTATACATCTTGGGCCACCAGTAGTGAGTGCTCACGGAGCTGTAGGTCTTCTCCCGACCTAAGTGCCCGCCGAAAGGCGTGTCGTG
AGCCTCGTAGAGGATAAGGTACTTCAAATCCTCATCATGAGGGACAACCACTCGTGGAGGATCCTCAGGATCGGTACTGTAGTACAACAGACCACCATCG
AGCGACTATCGATGCAGCCTCGCGCGCATGCGCGCCGACAGTTTACTGTCCGAGTTCTCAAACTCCTTACTTCCCAGAGCACGTAGCATAGCTACACACG
AATCGTCGTTAGCATACGCCGAGCGTATCTGATCCGTCAACGACGACGTCACCGTCATGATATGAGCGAGCTCATAGTCTGGCCGGCGCGACAGCTCATC
GGCTAGGGCGTTCTGCCTGCCAGGCTTATACTTCACCTCGAAGTTATACTCCGCAAAGAAGGAGAGCCATCGAGCCATCCTCTGTGAGAGGTGAGGCGAC
TGTATCGCAGTGCGTAGCGACGCATGATCTGTGTAGATCACGAATGGCTTGGAGCCGAGCAGGTGGACCCTGAACTTGACAAGAGCGTACTTCATCGCAA
GTAGCTCCTTGTCATGAACTGGATAGTTTTTCTCAGCAGCCTTCAGCTGCCGAGACTCAAATGCGATCACGCGTTCACGCCCGTCAGCGTCTTCCCGTAA
CAGGGCACTGCCGATGGCAAAGTCCGATGCGTCACAGACGGCACTGAAAGGGCGGTCAGGGTCTGGCAAGGCCAGGATAAGGGCATGAAGAAGACTCTCC
TTAACCGCCTCAAAGGCGTCGTGCTCACTAGAGCCCCAGCACCACTCAGCATCCTTCTTAACCCTATTGCCGCCAACAATGCAATTTGCTTGGTTTTACT
TTTTTTTTAGCCCAATCAGAGTGCTCCATTACCATTTTGGACCAATCATGTCACTTTCGGCAACCCATGCAATATGCTTGGCTTTACTACAATAATTACA
ATAATTATTGGTAAACCGATGCAATATGGCATATTGGGCTGCGGAATGCGGAGTTAAACCAAGCATATATGCATGTTTTACCTTTTACTATGGAGTATCA
GGTATACAAATTCTAAGTATATTTTTGGCAGCAATAGGGTTATGGAGATTCAACAATGGCCTAGCCATCTCCGAATAGTTTGCGCTGTACTAGTGCAAGT
AGTTGGCCAGGCCCAACCACTTCCTTAAGTCCTTCTGGTTCATCGGAACCGGCCAATCCACAATGGCCTTGACCTTGGCGGGGTCCGCCCTAAGGCCACG
CTTTACGATGAAGCACCCTAAGAAGGGAATCTCTTCTGCTCCGAAGATGCAATTGTCTGCGCTAGCATACAGCTTGTTCGTGCGCATGCACTCGAGCACC
GCTCGCAAGTGGTCAACGTGGTTCTCCACATCCGACCTACCGTGCTCCGTACGACTGTGGACGAAGATATCGTCAAAGTACGTCTGTGCGTACGCCCGGT
GGGGCCTAAACAACTGCGTCACAAGACGATTAAACGTCGCTGGTGCGTTCGATAGCCCTTGGGGCATTACTAGCCACTCCCAGAGCATATCGCTTGGAGT
ACTGACCGCCGTCAGCGGTATATCTTGCACTCGCATGAGCAACAGATAGTATCCATCGACCAAGTCGAGGGCACTGTACATCGTACAGCCCACCATGTTG
TTCTGAAGAACATCCTTCCTAGGAATAGGCGTCTGCGCCGGGATCGTGGTTGCGTTCAGCTTGTTAAAGGCATGAACAATGCGCCACTTGCCGTTCGGCT
TTCTGACACAGAATGTAAGCGTAGAGTGCGGAGACTTGCTCTCACGCACCATTCCAGCCTCGTGCTTCGCACGGAAGAAAGCGTCGATGACGTCACACTG
CTCCTTCGGCAAGGACCACTGCCTCGTCACGCAGTATTTGGTTCCGAGAACCAGGTCAATCTCATGACGAACACCTCGGTCCGGAGGTAGGCCCGAGGGT
GGGCCCTTCGAGATCACATCCTGGTACTCCTTGACCAAAGGATAGAACGGATCCGACGGGTCCTTCAGGATCGCCGATCCTCTGCGCGCGTTGAGCGCCT
TCTTGGTGTCCCCAAAGACGGCTTCATCTAG