Description :
From Genome Similarity Track
Location :
Scaffold_758:450- 7017
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_758-snap-gene-0.8Endo-1,3(4)-beta-glucanase
Pytir_DAOMBR486maker-pir_contig_758-fgenesh-gene-0.0Proline synthetase co-transcribed bacterial protein
Pytir_DAOMBR486maker-pir_contig_758-snap-gene-0.9NOP17

Sequence
6567 bases(100 bases per row)
CTCCCTTCGCTCCATTCTCGTGGCTTCAAGCGCGCTTCTTTTGACTGTGAATAGTGGATGTAATTCCGTGCCGACATTGGCTGATCGCACTTCAGTTCAG
CTTTGGTCAGCCAAGCTAGCCCTTCCTGGTTGACATATATTGTGCCTGCCCGTCCACATAGCTTTCTCCGATACTCACTGAGGAGAGAAGGGCATTACGT
CCATCTCAAATTTCTATCTAGGTTCATAACGTCCATCTAAGCGCGACAATCATCGTCCACATTGTCGTGAAAAACAAGTACACCTGACAGAAAAAACGTT
TGTCATTTCTCCATTATGAAACTCAAAAATATCAATGGTGTGGCTTCACCACAGCGGTCTCTCTCTCACACTCTCTTACTGCTCTGCTGCAAACTCAAAA
AAACTCAAGCTACAAAGTTACAGACTTAAGGACGCGTCGCCGCCATGTAGAGCGCCCACGAGCGCGTCAGTCCGTCGTCCATCGTCGCCGTCTGGAGCTT
CGTCATCGCCACGTCCTTGTTTACCGTCGCATAATTGGCGTACAGCAGCGAGAGCCACGAGTTAGTCATGTCGTTGTTCAGCACGATTGCCTCGCGCGCG
AGCACTTGATTCCACTCCTCCTCAACAAACTGACGCGAGCGGACGTACTCGGTCACGGGCGAGATCGGGATCATCTGGATACCGTGGATTGCGTATTTCT
CGGGGCTAAACCACGTGGCATAGTCAATTTTGTTGTCGAACATGATGCCCGTGACCTTGTTGGGGCGGATCTGCGCTGGTTGCGCCACGTTCGCGTCTGT
CATGAGAAAGTACGTCTTGATGGCGCGGACATCCAGCTTGAGCATCAACTTGCCGATGCGAGTGAGCTCCGCGTCGTTCGTCACCTGGCCGAAGAGCACA
AGTCCGTAGTGGAAGTTGACGTCCTCCGACGTGCTCTCCTGGTCCTTGCCGTCTGCGAACGGAGTCACGCCGTGCGAGTACGAGTGGCCGCGGTACCAGT
CAAAGTTGCGGAACTTTGGGAAGTACGTGTCGCTCCACGACGGGTTCGCAACATCGCGGATTAGGAAGCTGGTCATGCGGTTGAGCTCGGCAATGCGCGA
CCAGGTCGGCTCAAGGCGGTTCACGATCGCCGCCGTGACGATCCAGTAGCCAAAGTGGTAGTGATGGTCATTGTACATGGTGTTGCCGAAGTCCGCGTTG
ATGTCGTTCTTCTTGAAGCCCTCCGAGCTCAAGATGCCGCGGTAGACCGTGTCGTAGCTCAGCGTGTTGGTCCACTTGTTCTCCAGGAACGGCACCAGGA
TGGTCTTGAGCTTTGTCAAACACTCACTACGAAGTCCTGTGTCAGTGCCGACGATCGAGGTGTCGCTCGCCATCAGGCACAGGGACGCGTACTTCTGCGC
AGCCTTGCCGTTGAAGTAGTAGCTCCCGTCAAGCGGGATGCTCCATGCGGCTCGGATATCCGTCGTCAACGTTTCTTTGATCTTCTGCGCTGCGACAACA
CTCGCAGCAGGCTTACGCGGAGGGTAGAAGTCAACGGGGATGCTTGTCGTGTCGCTGAAGCGCCACACTGGAGGCGACGTCTTCGTCAGCAGCGCCGTCA
TCTTGCCGCGTGTGGTGGAGAACGCTTCAATCCCGCTGGCTTCGGCAGCGCTCGTGCGGTCCAGCGTATCCACGTGGTGGATCTGGGCGTAGTGAAGCAT
GCCCGCGCCGCAGTTGCCGCTCGTCTTCCAGTTGTACGAGTACGAGTTCTCGTCGCGCGCCTCGACATCTCCACCCTCAAGCACGCAGAAGCGTGCTTNN
NNNNNNNNNNNNNNNNNAAAAATCGCTTGCTTGTCCGCGCTCGGGATCATCGCGGTACGCACTGTGCCGGTGAAAAGCGACTGTCCGATCAACTTGGACA
TTCCGTCCACACGCAACGCAACACTTGAGGAGAAGTAAAGTGTCCATCTCTGTCCGTTGTTGAGCTCCAGCACGAAACGGTCGCTGTTCGTCACCAACCC
CGAGACCGCGTTCTGTCCATTGACGCTGATGATCGCAAAGAGCGTCGAGAAGCTCGGCGTCAGCGCAGTGTATTTGGCAGTCGCGAACGCCATGCCGCTC
ACCAAGGTGGACTCGAACTTGCCTGAGCCCTTCGAGAAGCGCAGTTGGACACTCAGGTCGTCCCATCCGAAGATCTCAAACGTTGGCGCAATCGTGAACT
CGACCGCCGAGAACACGATCTCCTCCACGACGCTGTGGAGGTAGAACTTGTTCGCGTTGCCGTTGCCCGTGGCGCCACCGTAGCCGCGCGTCGTGTACGG
ATAGCTGACGCTGAGTCCGAACGGAGCGTTGACGACCAGTGGACGCACCGCGTACGGGTTCACCCACGCCGGCTGCACGGTCGCATCGGTGGTCGCGGCG
ATCATGTTGCCCCACCAGTTGTTGGTCGGGATCGCCTTGCTCCCGACCAGACCAGCAGCCATGAAGCGCGGCGGCAAGAGCGTCTTGTGCGCATCCGTGT
ACGGGAACAGCGACTGCGGCGGGGCTTCAGTCGAGAAGGCGGCGAAGAGCTCAAAGCCTGCTTTCGGCGCGATCGTGACGTTGCCCTGCAGCTGGAGCTG
GGCGAGCGCGCTCGGGGCGAACGCTGCCGCCAGAGCGAGGCAAGCGAGAGGGAACTGCACCATGGTGATGAATGACAATTGGGGTTTTTCTTTTTTCTTA
GAGTCGTGGGGGTCGTGCGATCGTGTGGTGCTCTATGCTTGAGGACTTCTTCGCAAATTGACGAATGAGGAGAGTTGGTTGCAAGTACGTCGAGAGGCAA
GCGCGTGCCTCCTCTTACAGAGCAACGCCTGAGCTCTGCATGATGCTGGTCAACGCAATTGCATGCAAGCAGGCACGCGCCTAGCCAGTGTGTATCGGTT
CCACTTGCAGCGGCATAGTTTGGTCACGGTCACGGCATCCCTTCCTTCCAATCCTTCGAGAAAGATTGAATGAATGAAGCGGAGGCGCGCTATTGAAGTA
GGTTTTGCGGCCATCAACGGTGAACAGCACAGCAAGCTGCAGGGCTATCTCCCTTGGTCGTTTCCCATTCCAGACTGCCTTTGAGGAATGGATCTTTGCT
TGATTCACGAGCACTTCAGCTTCAGTCTGATCCCCATCCATCTTTGCTTTAGTAAGAGTGCCTCTGTGCCTCTGTGCCTCTACCCAAACAGCAACTGAGG
TATCAAAGGACATCGCGAAAGCTGACGTGACGGAGCTGCTGCGAGCCTCTCTCCTTCAAAAAGCGATGCTCGGATAAATCAAGTGATGTCGCTTCGCTGG
CAAATGCTCACATCCCCAAGCGCACGCTGCAGTACACACCACCAGTCGTTCGAAAATGCAACTTCAACTGCCTGTCCAAAGCGCATCGCTGGTTTCAAAG
GCGAGCTCTGATTGCTTGGGCTTGGATGGCGCCTCTGGTGTGTAGACTACCACAACTTTGTACAGTACACGGTGTACTCAGATCTTGCCACGTCCACTTC
TGGGTACGTACCTACCTGCTGTGCCGCAGTTGAATGGGATGATACAGAAAACCTTCGAATCATCACCCTGGGTTCCCAAGTGACAGGATCGGCAGAGACT
GAGGCTGAGCACGAAAAAGATTGAAGCCGCGCACTGGAACGGGAGGTTGATCGGATCGGCAGAGTGGCACTCATTTACATCGAAACGCCACAAGTTCAAG
TTGGAAAACCACGTTGGTCGTCGCAGCCGCACCAGCCGTCATCACGAGTTGATGGCGAGCGAACCAATAACCAGAGAAGCTGTGCATTCGTATTCTTCAC
CACTGGCGGCTGTTGCTCATGTGCACTGCTGCTGTGTGCAGGTGGAGAAAGAGGCAATCGACTAGCTCGCCTCGCGTCTCGCCATTTCGGTCCGTTCGGC
CCATTATGACCAGCGAAGAGTGACATTCTGATTCCACAGCTGGAATAATAGCACTGTGAAGCATATATTATTCACATTTGGGAAAACGTCAGTTATGTAT
CAACAAAGTCCTTGTAATCCGCGACATCGTGTGGGTCATTCACCTCTACACAGGTCAACTCGAGATAAAGTGCGTCGTAGTTTGGCGAGCTTGACGAATC
GGTTCGTTGATCAGGGGTTGAGAGCGTATCGGCAATTCCCGAGCGTTCGTTCGCGCCACAGAAAATATATGTAAATATTACGATGCCTACTGAGCTATAT
CTTGTGGCACACCGAAGTGGAGCTACTGGTGGCAGTAGCCACCTTATCTTGAATTGTGGCCTACCTCACATCGAATACCACCATCCAAAGGTTTTTGCGT
CTGCCGCCATAATGTGTTGGGTCCTGTTGTGAGAAAGAAAGTGAACGAAGGACCGATAGTAAAGTGATGGCGTCCAGCGCGAGTGCGAGCGCCGTAGTGC
GCAACCTGCAGGCCGTGCGCGCAAAAGTGGCGCAGGCGGTGGCCATAAGCGCCTGGAAGCAGCAGGTGCGTCTCCATGTCTTTGTGTTTGCAGTTCTCCC
ACTGTGTTCGTCGATCAAGAGCCGTCGAGAGAAAGAGAGCAATTGCGTCGTTCGTGCGGGTTCTTTTTTCGACCAGCTGACAAAGCCACTGATGAAATTG
TGAATGTGGATGGACGGATGGATGGATGGCTATCCTCTGTGCGCACTTGCGTATGTGGATTGCATTAGTGCACGCTTGTGGCTGTGAGCAAGACCAAACC
GATCGAGGACCTACAAGCCGCGTACGAGCACGACCAGCGCCATTTTGGTGAAAACTACGTACGTCTCTGCATCCCCATTCAGTAGCCATGTGGGTGGCTC
AAGATCACTTTCTAATGTGAGCCTGGCAATACAATCCGCTTTGTTCATTTGTCGTACAGATCCAGGAGCTCATCACGAAGACGTCACTGCTTCCGGCGGA
CGTCAAGTGGCACTACATCGGCCACGTACAGTCGAACAAAGCCAAGGCGCTCGTGCGCGACGTGCCCAACCTGTTCATGGTGGAGACCGTGGACTCGATC
AAGATCGCAAACGCGCTCAACAAAGCGTCGGGCGAGTTCCGCTCCAGCCAGCTCAACGTGCTGCTGCAGGTGAACACGAGCGGCGAGGAGCAGAAGAGCG
GCACCACATCGCTCGAGGACTCGGTCGAGCTCGCACAGCACATCGTCAACTCGTGCGAGCACCTACGCCTCGCCGGGCTCATGACCATTGGTCGCTACGG
TGATACCACGTCCGGGTGCTTCGATCGCCTCGTTGCGTGCCGAAAGGCAATCGCAGAGGCGCTCGGCAAGCCTGAGACTGAGCTCGGGCTCAGCATGGGC
ATGTCGGGCGACTACGAGCTGGCGGTACGTGTTGTACTACTCGACTGTGTTTGTCATAGCTTGACAGTGGAACTCAATACTGGTGAATTTGAATGTGTGT
GTGGCTGTAGATCGCCTGTGGAAGCACGTATGTCCGCGTCGGCTCGACCATTTTTGGCGACCGCAACTACTCCAATGCATAGAGAGAGAGACAACGGAGG
CTTTGCATAGCTGATGGCGTACACAGCAACTCCCACGAGTTATAACATACAGATTTTCAAGCATTTCATACGAATATCGTGTTTCCATTTACAACAATCA
CCAGCAATATCTCGAGCCTTCTTCGTCTAAGACCTTGCCTGATTGTCGACGATCAGTGTCGTGTCGCGAGGAGAGTTGCCTGACCTAATCTAACAGGTCA
AATGCGAGCGCCGAGCGCAAGTCCAGCTTCTTGTCTTTCTTCTTGTTCTCTGACCACGCAGCAGCCACCTTGATCGCGTCTTCAGTCGGCAGCAACTGGA
CTTTCGCTTGGGTATCTGGCTGTTCTTTTGCTTCTGTTGGCGTCTGTGTGGATTGCCTCGTTTTCTGCTTCTCGAAGATGTCGTCCATGTCGATGTACGT
CATCTCGGGCTCGTTCGGGTACATCTCTTGCCAGCTCTTTCCTGCGTCCTTTGCCTTGCGTTGCTTCTCCTGGACTTCCGCTCGCTGCGCTCTTCGCTTC
GCCTCTGATTCTTTTGCTTTTTGGTCTCGCTCGGCCTTGCGCTGCTCGAGAATGTGCATCGACATCATGTCCTTGCGGTGAAAATGGTCTTCCGGAAGCT
CTTCGTATTCGTCCACCGGGTCCCACTTTGTTGCTTGCGTTGAGTTGCTGGTGATCGTGGCGCTACTGACTTGTTCTGAGTCTCGAGCGTTCGGCTGTTC
GAGGTGAAACATCTCAGCCAGAGACTTTGGTTTCAGAGGTTCTCTTTTCACCTCTTGCTTGTGTGAAGACGAGTTATCCCCACCAACGTTGCCACCATCT
AACGCTTGTGCTAATAGCCATGGCGCAGACCCGCAGTCTGCATTCCCGCTGTCCCATTTCTTATCGATTGACAATTTCACATGGAGACTGTTCGGTCGCA
GGTTGAGAGCGACTTGAGCGGAATTCACGATCACGGGGTACGGAAGGAAGACACCTAAACATTCAAGAAAAGCAAGCGGATGAGATAAACATCAATGGAT
CAGTAGCATCACCAGGCAGGGAGAAGCAAACGACCACGTACTCAGATCCTGGTGCCCAACTGCCTTG