Description :
From Genome Similarity Track
Location :
contig_262:450- 5055
Transcript NameFunction/comments
g14429.t1hypothetical protein

Sequence
4605 bases(100 bases per row)
CTTCTCCATCAGCACCAGCAGTCGTCGCGGGGACGTTTACCTGGATACTCTCGCCGCTACCCGAAAACAGCGGCAATCACGATTCGGTGCTCGCTGGAAG
TTCTTTCTTCGGACGATCTTGCGTGGACTGGTCGAGGGTCGGTGTGATTTGGACATTCTGCTCGATCCTTTCTTCATGCACCGACCTCGGCCGGGTGAGG
AGAAGATGTGGTATCCAGGGCAGCATGGCAACTCGCAGGCGACGAATCTGATCACCGCAGTCCAAGAGGCGGACTTGGCTGAGCCCTGGCGAGTCCAATA
CCGCCACGACATCCGATCGCATCCCGCGCAACGCATTGCGCGTCTTCGTAGCAAATTCGTCATCCCAGCTTCCCCTTAAGCGTACACTTGAGTGTTAGTC
TGCATGTAATTCCATTTTCACCTCTTTTTCTCCAGTTGTCTTCCTTGATCGGGTCGATCGAACCTCGTAATCGGTTCTCTCCCCCTTCACGCCACTTGTT
TTTTGTACATATACCTCCTCCTTCTTTCTGAGTGCAGCCGCCCTGCACCCAATTCACTCTCAACTCGCAGCGATCGCCACGAGTTGCCCTCCTTCTTCCT
AAGTGCAGCCACCCTGCACCCATTTCACTCCCAACTCGCAGCGATCACTACGAGTTGTCCTCCTCTGCCTCGTGCGATTGCATCACTCCGAAGCGATTCC
GTCTAGTACGCTCGCGCTCAAACTCGTGCATCAAAGCCCCGCAGTTGAGGTCAGCCTCGTCGACCCAAGACGGTTCGGTGTACCCCTTCCAGAAGACCTG
GAATTCCCGATGGACGCGTCCATATCTGGTCTTACGGCCCGATCGGACATCTGTGATCCGCTCCACTTCAAACTCGTCATCACTCCGATCACCTTCCCAG
CTGTCCTCGGCAACAACGCCTCATCAAAATCAAATCGACCATTCTCGTCCGTTGCTAGCGTCACGTCAGGGCGATCAGAGAAAACCTTCACGGCCTTGAG
CTTCGAGACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCCACCTCTAGCCGGGCCGCGTAGGGGCCAATCATCTCGCGCACCCGGAACGGTCCG
TGCCACATGTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGATCCAAATATAGCCACACTTGTGACCCGGCCTCAATCTGGTGCGGCCTTATCCCGT
CGTTGTGGCGATCGGCTCTCGTTTGGATCGCCTCCTTCAGGCGCGCGTTGACCTCCTCGCGAGCTCGCTGGTACTGTTGCTGGATACGATATCTCCATCT
GCGCGGCTCGCGATCGCGACGTCGCGTGCTGCCTAACGGTAGCGACGCTTCCAAGGTCGATCGTGGGTCCCAGCCATGGACAAGGTAAAACGGCGTCTCT
CCTCGTACTCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTATTCGTCCCAGTCTTGTTGATTCACATCGGCGACATACATCTTCAAAG
CGCGAGTAAGCGTTTGCACCATCCGCTCAGCGGTACCGTTTGCCTGTGGTCGATAGGCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATGC
GCGGAAGAAATCAGACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGATG
GTCTGCGCTGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCGACCCACACGAGAAGCTCCGTGTTGCCCTTGAACGACTTTGGCA
GAGATGGGATGTGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCCCAGGTGATTCTCCTTGAACCACGGGGCGCCCTTCCCTGTCTCG
CAATCCACGCATTCACCCACAAACCTGGACACTCTTGAACAGCCCCCGCCAGTGGAAGTGCGCTTTGATCCGTTGGTACGTCCTCCCAGTTCCCTGGTGC
CCTCCTTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTGGTGTAACGTTGCAGGTACCACCAGACGCGATCGAATCTCGGTCCTCGTCTAACCGGGTG
GTGTTCACACAGTAGAACAGCAGGCCGTCTTCCCCTTCGTAATCTCCAGCGATCTTGGCGCACGCTTTTGCATCTCTGGTAGTTAAGGCTGCTACGTCGC
CCCGTAGGTACGACTTCAGGTCCACGATCCACTTCTCTTCATCCTGAGCTTGTACTAACCTCTCACTCCTCATGCGTTGGACGATCTCTTCTTGCATAGC
TGCCGGCACTTGACGGTGCCGTCGGGCTGATCGGGTCACTGCTGATATTTGAACGACGGGGTCGTCATTACTCGGGTGGAGCAACTCGCCCAGGCGGTTG
ATCGTGACGAGATCGCCAATTTCGCCCTCATCAGTTACGATCACGCCTGCTTCTCGTTGCAGTGCCGCACTTGCCAACCGATCGGCGCTCTGATTCCAAT
CGCGCTTCACATGGAGGAATTCGTGCTTCGGCCAGGCTTTCACTTGATCCATCGCTTTCTGACGTAGTATCTGGAGACCCGGTGCCTTGCAATCGATTTC
ACCACGCATCTGTCGGATGATCAGATTGGAATCTCCACAGATCACAACTCGCCCCCTGTTCTGATCGGACAGTAGCTTGAAGCCTAGCAGAAGTCCGCGA
TATTCGGCTTCGTTGACAGTCAGATCGTCGGCGAATTCGGATGCGGCAGATATGATCGACCACTCCGGGAGCTTCCAAACAATTGCACTATACGCTCCGG
CGCTCCGCTTGACGCGTGCTGACCCATCAAAACTGACGACGAGCAACTCTTCATCCAGCTCTACCGTCGGCGGGGCCATCACGATCGTTCGTTTGGGCTC
TTTCACCGGTGCAATCGCGATCAAGGCCTCGTCCACTTCCGCTCGGGGTGTAATGCTGGCGGCGATCGCGCCCAGGATTTCGTCCTCTCCTTTCAAGCAC
TTCCGGATTTCCAAGGTCCACTCGGACAGCAGAGCTGCCCATCGTCCCAATCGTCCCTGGAAGCCCGACGCATTCAGCAACCAGGCGAGCGTCGAATACC
TCGACAGCACCTTGATCGATCGGTTGGTCAGGAGTGTGTAACACACGTCCAAGATCCGGAGGAGCGCCAAAACTTCCTTGTCCACTATGCCGTAATTCAA
TTCGTTCGACTTCAGCGTACGACTGGTGAAGATCACAGGCCAATATATGCCATCATGTTCCTGAACCAACGCAGCTGAAATAGCCCACTTGTTGGCGTAG
ACCACGATCACAGGCTGGCGATCAGAATCGAAGTGTCGCAAAATCGGGGTGGTCGCAAGCTTGGCCTTCAGTAGGTCGAACGCCGTCCTCGCTCTAGTCC
ACCGATCGTCGGACTCCGCTGCTCGGTCCTCATGCTTCCCGTGGTGCATCTCGTAGAAGTCCACTTCTCGCAGTTCGTATAAGATCGCGGCGTAAACGGC
GAAGTCTTCAATGAAGCGACTGTAATAATTCAGGCTTCCTAAGAAGGACTGCATCGATCGCAACGTCTTCGGAAACGGCAGCTTCTCCAGCGATTCCAGA
TCTTTCGGATTGGCTTCCAAACCATCGGCCGATACCCGATGACCCAAGTACTCTACCTTCCGATGTCCCCAGAAACTCTTGACCACGCTGATCGACAGGT
TCCATCGCTCGCAAGCGTCAAGCAGTGCCTCGACCTTCTCGCAGATCGAGTCCCAGGTGTCAGCGGTGATCAGGATATCGTCGATGTACGATCGCCTGCC
CAGCACCGAAGGTCCCGGGTTTGCCTCGGGTTCCCCTTTCTCGAACACGTCGGTTGGTTCCGTGTGGTCTCGATCAGGGCTTATCCGGAGGTATCCGTAC
AGAGCATTATCGATCAGCCTCTGGTAGATTTGTGGGGCGTTCTTCAGCCCGAAGGGCATACGCGTCCACTCGAAGAGTCCGAAAGGCGTAACGAACGCGG
AGATCTTCCGTGCACGTTCCGTCATGGAGACCACCCAAAAACCACTAGCCATATCCAAAGAGCAGTACCAGAGTACTTTGTCCAAGTCCTCCAAGAGATC
GTTGATCAGCGGCATGGGATATACCATCAACCTGGTCAGGCTATTCACCAAACGGTAGTCGATGCACAGCCGGATGTCGACTCCATTCTTCTTATGATGA
TCACGATCGGGGATGCCCATGGTGAGGTTGATGGCTCAATCATTTTCGCGGACAACAAACTCTTGATCAGATCAGACAGTTTCTCTCGGAATTGAGGGGC
CACCCTCCGCACGCGTTGGGCGATGGGAGCGGCTCCTCCAACGTCGATGTCGCACACCGCACCAATCGCAGCGGGTGGAAGGGCGTTCCCTTTACCGATC
AGCAAGTGTCGTCGCCGCCAGATGATCTGGCGAAGTCGATCGATCTCCTCAGGTGTATTCGTTTCCGGATCACCTACTTGAATGTCTTCGATCGTGACTT
CGTCGGTAGTGATCGGCACTTCGGGTAGGATAGCCATCTGGCTTTCCACGTCTTCCGCAAACAAGGCACCACCTTCATGGAAACACACCTCTTCGTCTTC
TGGAG