Description :
From Genome Similarity Track
Location :
Scaffold_3259:450- 2595
Sequence
2145 bases(100 bases per row)
ACGTCACTCTTTTTGCATAAACATTCACTCCTTCCTCCTAATCCACCCCTCTCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCA
GCGATCCTCCTCCTCCTGGCCCACACCCTTCCTGTGGGCCCTTCTTCATCCTTCCATCGACATGACCAACTCACATCCATGGGTCCCCTCCCTACTCTTC
TTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAA
CTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCCTCCGTATCTAGTTCGCTCCCCCGACCTCATATCGGTGATCCTCTCGACTT
CGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAGTCGACGCGATCGGATCCATCCACCGAAAGACGGATCTG
CGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCCTTACCGCATGT
TCTCCAATCTTCTCGCTCACCTGGAACGGTCCATGCCATAGGTGGGCTAATTTGCGGGCATACCCCTCTTTCACCCGATCCAAATAAAGCCACACCTGCG
ATCCCACTTGATTTGATGTGGACGGGGCATCTTCGCTGTGTCGATCCGCTCGACCGTGTATCGCACTCCGCAGTCGTTCGGTTCACCTGGGATCTAGCTT
GCCGATAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTCCTCTTCTTGGTGCTACACACCGGAATGGTCGCTTCTAAAGTAGATTTAGG
ATCCCACCCATGTACCAAGTAAAATGGGGTGTCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCC
CTCTGATCCAAATCCTGAACATACATCTTGAACGCCCTCGTGATCGTCTGTACCATGCGTTCGGCTGATCCATTGGCTTGGGGACGATATGCCATAGTCG
CCCGCTGTCTCTGCCCCAGGACCCGGTTGAAGGCTCGAAAGAAATCAGACATAAAGTCTGGCTCCCGATCATGCCGAGCCATCTCAGTAGCTCCAAATCT
TCGAAAAACGCACTCCTCGTACGATTCGGCGATGATTTGTGCAGTTCTAGACGCGCTAGCTTTGGCTATCACGTATCCGGTAAACAGATCCACCCCGATC
AACAATTCTGTGTTTCCTTTGAACGACTTGGGTAACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACT
CCTCTTCGATTGTGGGTCTGCCTTTGCCTGTCTCGCAATCCACATATTCACCGACATATCGTTGTACACTTTTGAATAGTCCCCTCCAGTGGAAACATTC
CCGGATCCGTTGGTAGGTCCGACCAATTCCCTGATGTCCACCTTCTAAACTAGCGTGATAGTGATGTAGGCCATCCTGCTGTAACGTTTCCGGCATCACC
AGTCTCATCAATCCGTCTCGATCCTCGTTGACTCTCTTCGTAGGGGGACAATAGAAGAGCAAATCATTCAGATCCACTGCATAATCCGTACCGCTAATAC
GGTAGGATTTGGTATCCCCCCGACTCAGGTCTCGTACACCCCCCATCATATACTTCTTTAGTCCCAAGATCCACGCTTCTTCGTTCTGTGCTTTGAGGAT
CCGCTCAATGCGGACTCCCTTCACACATGTTTCATTGAGAATCTGGGGGCTGGATCCAATCGTCCCTCTGGATCTAGTGGCCGCCATTACCTGGACTGTC
CTTTTTACGGATCCAACCACCACCACTTCGTCTAGTCGGTTTAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACCTCAACACCACATTGATTCC
GTAAAGCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGTACTAACTCGTGATTCATCCAACCACGCAGGTGGACCATCACCTT
CTGCCGTAACAGCGCTAGGGCCAGTGGCCTTGCAGTCAATCTCAC