Description :
From Genome Similarity Track
Location :
Scaffold_1918:45- 5186
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1918-fgenesh-gene-0.0Aspartate racemase
Pytiw_DAOMBR242034maker-piw_contig_1918-fgenesh-gene-0.2Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1918-snap-gene-0.4Voltage-gated Ion Channel (VIC) Superfamily

Sequence
5141 bases(100 bases per row)
GCGAGCGCCGCGATGAACCAGGAGCAGCAGACGATACTCGGCATCTGCGGCGGTGTCGGACCCGCAGCAGGCGTGTTGCTGCACCAGATCATCCTCGAGC
ACACGGAGAGCGGCGGCAGCGACCAGGGTCACCTCAACGTGTGCCACTTCTCGCGCTCTGAAGACATGACCGACCGCACTGAGTACCTGCAGCACGCCAT
ACACGACAACAGCAGGACTGGTGTGCGCGCGGCCGATGGGACACCGACGTGGGTTGAAAACCCTGCCTGCGGAATGGCGCGGACGTTCGAGATGATGAAG
GCCGCCGCCGCTGCCGGCAGCAACGCGCGCCTCGTCACAGGCGTGCCCTGCAACACTTTCCACGCCAAGCCGATCTGGGAAGAGTTCCTGCGTCTCACAG
CGCCGTCTTCAAAGCCGCCCTGGGTACAGCATGTGCACATGCTCGAAGAAACGGTGCGGTTCATCGCGCAATGCGCGCCGACGTGCACACAGATCGGGCT
CATGGCGACCACCGGGACCCGGGAATCCCGTGTGTATCACAACCTCATGGAGCCGCTTGGGTACAGGATCATCGAAATTTGTCCATCGCTCCAGGTCGAG
TTGCACGAGTCCATCTACAACAAGGTCTGGGGCATCAAGAGCACGGCGCCGACTGTGAAGCGACGTTGTGTCACGAACTTCCACCGGTACGCACGGCATC
TGAAGGAGAACGGCGCCGAGGTGATCGTCATGGGCTGCACGGAGATCCCGTTTGCGTTCACAGGCCGCAAGTCCGTCGCTGGCGTGCTGCTCATTGACCC
TCTCGTCGCGCTCGCTCGCGCCATGATTCGAGAAGCTGACCCGTCACGCCTGAAGCCCCTGGAGATCGGACGGCGCCGCTGGAAAAGCTGCCAAAGCTCT
GACAGTCTGCACAGTGCGACAGATATTGCGGCCTAGTTCACGAGCAATAGGTTGTTAAAGTTAGGAGTGCAGTGGTCACAGACAAGCGTATCAGTTTAGA
TTAGAGCATGTATGCATGTATTTATCCCCAGCAGCTCACGACTTACATTGTACAAGAGCGAGTCGACAGTATCTTGATTTCTGCCACTTCTTTCACATCA
GCGAACCGAGTTGGTTGAGAAACTCGGTCGCTTTCACCGCCGCTGCCTGTTCATCCTGCGCACTCGTCTTCTGGTCATCTGGTGGCACATCCTCCAGCTG
CTCAGCAGCAGAGCTGCCACCTGCTTGCCGCCGCAATTTCTCCAAGCGAAGCTGCTTCCGAGTCTTCTTGTCGAGATGCGCGGACTTCGCGTGGCTCACG
CCTTCATGGACCTCCTGGAGGTACGTCTTCTCCTCCGAGTTGAAGCGCTTCTCCCACTGCGACACCACAAAGCTGCCGCCTGCAGACTGGGATGGAAGTT
GCTGCCGTTGATTGTCGCCTCGCTCAGGCGGGAAATCATATGACGACGCTTTCGCAGCTTCAGTTCGAGTCTGCAGCTGAAGAAACTTTGCGTACGCGGC
ACTATCCTTCGTGACGAGACGAACGCGGCCGAACTCGTCCGTGATCTCCACGCTCTCGCTTGCAATTGGTACAGCAGAGCCATTGCTCAATCCGGAATCC
CTTTTCGCGCCAAAGTCGACGAGACACTCCGCCAGGGCTGCTGTGGAGCTCCCTGATGCCGACACACGTCCACTCATCATGTCGTCGTACAGCTCCGCCT
TCTTCGCGAGCATCTCCCGCGACTTCCTATGCCATGCCTTGTTGTCGTCCTGTTCGTCCAGCTCGTCCTCACGCTCCGCATCATCCTGCTTCCTGCGCTT
CTCCACGCTGCGATTACACGCTTTCCCCAGCATCTGCTCATCCTTTGAGTGCGCCGCGCTTTCGCCATTGCGCTTTTTCGACGCCTTTAGGTGCGCAAAC
CTGCCAAAGCCGCGCGTCCCGCTGGCAGTTGATCCGTTGCCCTCATCGTCGCCGAGCAGCGCGTCCTGCAGACTGCGCTTGCGCTCCTGGCGCTCCTGCT
CCTTCTGGAACACGACGGCGCGCAGGTCCACGAGCGACTTGGCGTCCACCTTGATGGCCTTGGCCTTGGACGGCAGCAGCGCCGACTCGGTCAGGAACCC
GAGCGACATCCTTCCCTTCTCTGTGTGTGCTTGTCGGAAAATGCAACAGAAACTCGATAAAATAGGCTATATATCCTATCTTATTCATAAAAGAGAGAGA
TATCCCTTCGAAAGAGTGGTTTCCATGTTGCTTCAACTTGCTATTCCCAGACAAGTTGACCTTCGCTCGCTCACTTGCCATGCGCCTCTCTTGACTCGCA
CACAACAGCTCAACAGCTCACCGACAGTAGTGGAGGGCGAGTGTCGCCAACTGACAGACAGAAGAGCGCATGTTCCGATCCAAGATGGCGCCCGCGGGCC
GCGTGCTCCCAAACGCAGCAACCGCGACAGTCGCGGTCGAGAACAGCTCAGGCCAGGCCCATGTGTCAGCTACACACGCCAACACACCAGCGACAACTCC
ATCACCTGCTGACCCAGCACACAGCAACCAGAACGAGCCCACGCAACTGCCAAAGGACTCGAAACTAAAACCTGTAATGCACCAGGACTCGACGATCCGG
TCCGTGGGCAGCCTGCTGCTCAAGCCCGGTGGACAGATCAACGTGCTGCGCACGTCGCTGAACGAGCTAAACGAGCGCGTGAGCCATCGGTGGGTGCTCC
ACCCGACGTCGCAGCTCAAGACGGCATGGGACCTGCTGAGCGCGGCCGCGGTCGTGTACTACTCGTGGATGGTGCCGTTCATGATGTGCTTCGACTGGGT
GCCGCGCGCGCAGCGCACGACCGTGATCTTGCGCATCCTGGACGTCTGGGGCGCGCTCGACGTGCTGCTGCGCTTCCGCACGGGTATCATCGAGTACGGC
AACGTCGTGACGAACCCTAAGCGCATCCGCCACGCGTACGTCAAGTCCATCTGGTTCCCCATTGACCTCGTGGCCACGATCCCGTTCGAGTACCTCTTCC
AGGGCGACAACGTGTCGACGCGCAAGACGATCAAGATGATCAAGTACGTCAAGCTACCCCGGCTGCTGCGCATCGGGCGGTTTCTCAAGTACGTGCGCAA
GTACAAGAGGTACAGTAGCCTTGTCATCGCGCTCAACTCGGTGCTCTTTGCCTCGCACGTCGCTGGGTGCGTCTGGGTCGCTGTGCTCCAGCCGTGCGAC
TACCCAGAAGGCGGCGTATTCGAGAATCTCGACCCGCGATGCGCTCAGGGTCAGGATATGCACGTCTACTGGATCGCGTTCCACCACGGCATCGTGTCTC
TTCTGGGGATCTCCACCGCGCACATCGAGTCGACCGAGCAGTTCCTGAGCGGCGGGTTCCATCGCACGGAAGAGCAACTCGGCGATGCCATCTACGTCTG
GTCGAGCGCTGTGTCGATTCTTGGAGCAGTGCTTACGGCCGTGCTCTTTGGAACTGTCATCCAGCTCGTCCAAAGGTGCGTTATGTATGGACTGACAACC
TCCATCGCCTTTACTAGTAGAGAGTCCAACTCCTCACGGGTGTGTCTAAATCATTGTCGTGAAGCTGGAACCGAGCCGAGAACACGTTTCGCAAGAAAAT
GGACCAGATCTCGCACGAGATGGACGCGCTTTGCCTGCCAAAGTCGCTTCGGGTGCGTTGTCTTTGACCTCATGATCAGCAACTATGTTGGAGTCTGTGG
ATATCTAACATCGGGGTGTGTTGCTGTCCCACAATGATAGTCACGAGTGAATGCGTACTATGATTACCTATGGCTCAATGTGAGTCAGCCTTGACAATGT
CCATGATGTGATCGGTTGTGTCTAACTGTGGGGGACGCATTTGGACCAGAGCCGAACGTTTTCCGAGGAGCTTGATCTCCTGAAAGACAACGGCATGTCA
ATCGCGCTGCGCCAGCAGATCGCGATCTACTTGTTCAAGGATTACCTCCAGAAGATCCCGTTCTTCCAGCTCGCGACCGACAATGTCCTGGGCATGATCT
GCATGCAATTGCACCCGGTGATCTACATGCCCGAGGACTACATCATCCGCGAGGGCGACATCGGCAAAGAGCTATTCATGATCGTCAAGGGTATTGTGCG
CGTCATGCCTCCAAAGGACTCGGCGGACCCTGCTGCAGAGAAGAGGATCCTCCTCGGCGAGGGCGACTTCTTTGGCGAAATCGGCGTCGTCATGGAAGTG
GAACGCACGCGAAGTGTGCGCGCCGAGTGCATGGCGGAGCTTTGCATCCTCTCACGCGACGGCTTTGACAAGATTCTCGTCGAGTTCCCCGAGTTCGCGA
CCGCGATGAAGAAGCTCATAATCAAGCGCGTGGGGGAGATGTGGCAGTCTGACGCCGGCGATGCGGATCGCATGGAGAAGATGACGAGGCTCGCTGACTG
GAAGATGAAGCGCACTGTGCAGACGCACAGTAATGTGCAGAAGCTGCGCAGCTCGGCCCACCTCATCCATGCGTTTCGCTCCAAGGTACCGCAGGGTGAA
GAAGCTAATGCATTAACGACAGTCCCAGCTATAGAGAGCACCGATGTCCCTGTCAAAGAACCACGAGGTGAGACAACGCGAAGCTTGGAGTCGCTGTCGC
TGCTCGAACCGATCAGGGAGCTCGAATCGGAGCCGGAGAGCTCGGCGTTTGAGCGAAAACCGACGCTGGAGAACATGATGGAAGACATCTCTACTGCTGG
GGCGACTCAAGAACGACTTGGGAGCAAGAGTTTGGACCAGAAGGCTTTAGCTGCTGCCGTGATTCGTGGATCCTCGCCGTCAGAAGTGAGTGAAGCCCCC
TTTTCACCCGAAGTACAGGCTCAGCAGCTAACACGCGCAAGTGCAGAGCCCAAGGCAGCAACGCAAAAGGTCTATCGGAAGCTTGAGAAGGCGTTGCACC
AGATGGAGAAGAAGATGGAGACGCGTTTGGGGGATCTGGATGCCAAGATCGCGCAGCTTGTGCAGGTTTTAACGGCTTCTTCGCCTTCACAAACGAGTTC
CAGTGGTGTTATGACGAACAGATACGTGGCTGCAACTGCAGACACGCATCTCCGCGACGATACTGATTCGGACTGAGAAATGCTCCATGCCTGGTGAAGA
AAAGAAGACAGTGGCCGAGAAAGCAGGCGACTTGAAGAATG