Description :
From Genome Similarity Track
Location :
Scaffold_1243:45- 4242
Transcript NameFunction/comments
Phypl_g12869hypothetical protein

Sequence
4197 bases(100 bases per row)
TACGTCGACCCCCAGCAACACACATGGCAGTGTATAGTCGCTGGGTACACTTCGGATCTTCACCTTCCATGGACCCCAACATATCCTGGACGGTCGGGCA
GATCGGTCGTTAATCACTTCGCTTGAGTATACAGGAATCCTCCGTCTGGACCTGCCCATCCGGACTGTCCCTGTTCGGACGTCCCGCAATACAGTTGACT
GTATAACGGCCACTGGGCATAACTCAGATCATCGACCTTCCATGGATTTGCGACAGGTCGTCGTTCCGGTCGCGTTGGTCGGTCGTTAATTACTTGACCC
CAGTATACGACAACTGGGTACAACTCAGATCTTCGGCCCTAAATGGATTTGCGACAGGTCTCCGTCCCGGTTACGTTAGTCGGTCGTTAATCACTTGGAC
CCAGTATACGAGAACCGCGCAGCCTCTCTTTCCATAGATTCCCCATTCGGACTTCCCCACTTGGTCTCCTTCATCCAGACGCCTCCATCCAGAATGACCT
TTTACTGGTGACCATTTCATCCTCGTTCGTGACACTTTGGCAAGGTTGGCAAGACTTCGGGTCTCGTCTGCACTGCTGGTCGTCTAGACTTGGAGTCTGG
ATGGCTCTCGTCCGGACGCGAGATCGCTGTTGATGCCCACGCCCGATGACCAAACGGGGTCGTCGTCTCATTACGAGTCTGCCACCGAAGAAGTGGATAC
CGACAGCGTGGATGGCCAGCCGCGAATGCCATTGTGACCATCTGGTGCTGCAATGTTGCAAGATCGCGTCGGACGGGAGGCTAAAACCTCAACTCGTGAT
ACCAAGATCACAGCTGTAAGTCCAACACGTCACTCGCCGGAAAACCTGGAGTCATACTTCCAGGCTGCGATGGGACGTTTTCTGAAGGAGCAGCGAACGA
CCAATACGGTGCCTGATGTGACCCCGATTGGTGCAGTGGACGTAGAAATGGTGTCGGACGGGTCACCGGACCACCGCTGTTCGCCATGGGAATACGACCC
AGACGATTTTGATCTCACCACTCCAGCTCGTGTAGTTGTCGCTACAACGTCGACTCCAGGCACGGGTAGATCGACAATGGCTCCACAAATTCGCGTGTCC
GCAATGTCCGAGTTGAAAGAGTTTGCTGGGAAAGATGGTGATGAAGATCGAGCTCGATCTTGGGTCGGGAAGGTGAAGTCTGCGTTTGTTCGCGACGAAG
CACCTGACGACGAGAAGTGTTTGGTGTTTGGAGACCTCTTAACGGGACCTACTCGGAACTGGTACCGTCAGTTGAGTCGCACGACACGCAGCTCTTGGAA
AGATATACATCAGAGGTTTCTGAGGCAGTGCTGTGACCGGGGCGTTTCTGTCGCCCGACAGTATTATCATGCCCGGAAACGATCTGACGAGACGCGACTA
GAATACCCCCACCGCCTCAACGTGGCTGGTCTGCGTGCACGTCTCCAAGTGAAGGATGGGTCAGCTGAAGTCCGCCGCGAACATGTCGAGCATTTTATCG
AGACACTTGACGATCGCGATCTTGCCGACAGCCTGGCACTTCTGCGTTAGAAGAAACGCTGCGCTCCCGTCAATGCTCGAAGGCGCGTCAAAAGAAGATG
GTTTATCGATCGGTTAAGCCTCGCCAGAAGCCACCAGTCCCTGCTGCACCTTCTGCGTCTACTCGAGCGGTCCATGGGGTTCAATCGgccgacgacagca
gtgAGTCGGAAGAAGAGTCTAGTGGGTCCGATGGCGAAGCAAACCACCATAGGGTGTCCATGTCGTCAAGCGGAAACCACGAAGAACCCCAAGATCGAAG
GTCAAAGTCGCCCAACCTGGGGACGTCGCCGAAGCGCTGTTAGCATGCGGTTCTAGCAAACATAATGACCTTGATTGCTGGGGACGTTTGACCTGCGATA
AGTGTGGGCGGAAGGGACATCCGTCGGACCGATGCCTCTTCGTGTGCAAGACCTGTGGAGAAATTCATGAGGCCGAACTTTGTCCGATAGAAGAGTTCTA
CAACCTGATCCGTCAGTGGTTCAATCCCACCAAGCATGGAGGTATGTTGCCCCAAGCGGCGGAGAAGATGTTAAACTAGGACGCTCGCCAGGTTTGAATC
CGGTACGAGCCGAGCGTTCTAGCTTCTGCATCTATGCATATATCGAGAAGCAGTCAGAGACTTTGGTTAACAAGCTGATGACACCGACCCACAATACATG
TGATCTTCAAAGAAAAGCTGTGGTTGCTGTGGCAAGTCTTCATGAGGTCGACGAATACTCAAGATCGAATGTGATGATGGCCCTGAACATTTCGCCTGGG
GAATTGCGTGGTTACTGGATCTTCCACGTACCAGACAAGGAGTTCAAGCAAGCGAAAGCTATGGGGAAGATCAACAACGAAAAAACGACCATGTTGTTTG
ACAGTGGCGCCGAGGTGTCCATCTTGGACACCGCCTTTGCTCGTAAGGTTGGCTGCTACATTGACGAAAGTCAGACACTGGTATGCGAAGGTGTGCGGAA
CGCACTGTACGCGACAGAAGGTCGTACAAGGCTCAAGATCACGCTTGCCGGGAACTTGGTGTACTTTTCGACGCCTGGGTAGGCCCACCAAGTGGAGGCC
AAGATCTGATCTTGGGTATGGACTTCATGGTTCCTGCTGGGATACGTCTCGACCTGGCTGACGGTACGCTGTGCTTGCCCGACGAAGTCCGGGTAAGATG
TCTGGCCGCCGTCCACTATACGGTGAACCGGTGGAGCAGGTAACCCTGAAGGAGGATCGTGAAATCGACGTGAGGTATTCAACGGAAGTGAGATTGCGTA
TCCAGAAGTCGAGTCAACATAGACTATGGGTAACTCGTGGAGATCGATGGGTTCCTACCGTAACTGCTGGACCTGGCGACACTCGCTACTTACACCTGAC
GAACGTGAGTGATCGCAAGTTGACGGTGTATCAGAACAGCCTGGATCGCAATGTGACTGTCAGGAGAGCGTGTGTCGCGACTACCTGGATGTGTCTCAGT
GGGATCGCGCAGATATGACGAGTGGCAGAACCTCGCTTACCGTGCTACGACCTAcaaggaagacgacgcgTCGGTAGACGAAGTGCTGACAGGCCCCGCT
GTTGAGCGACCACACTATGTGACACCGAATGCGATCTTGTCCCGACTGCCGAACCCACGCGACGTTCGGGtgtgcagcgacagcggagaCAGCAGGGACG
AGGCCAAACCAGACGAGATCAGTCCAGCATACGACCTAGGTGCGGAGTGTGTGTGCGATTCACATACGTCGCCGCCCAGGGCGTACGTTTGCGTGGCCTC
GGAAACCGCgatcgacgacgaagacgctgctggaagacgcgAAAAGTCATCAATCCGCGACCACAAGACCGACACTGACCGAAACAAAGTTGACCTCGAT
CTTGCACGTGATCTCGATCTGGCAGGGGACGAACAAGTCTGCTTCAAGGAGAGTGGTGAACTGTTCGCTGAAGATCTCGCGAGCCAGATGACGGCATTGC
CGGAGGTCGCAGAGACGACGGAAGAAGTCAAGAGGGAGGATATAGACACGTGGCGGCTGGTTCCCAATaggaccagcgccttgtcccaGCATCTTCCGGA
GACCTTTGCGGATGGTTGGTCAGGAAgtcttgttgttggtggAGAAAGTCGCCCGTGGCGCCTGTGAAAGACCAAGAGTGATTGTGGAGTTTGATGTCCG
TGTGACGTCTGACTCAGACAGTCTATTGTGGCATACTGAGTTCAAGTGAGTGCCGAGGACGACTCCGGGCGAAGACTTTCCGAACGAAGAGGTTCGATTC
AGAACGACTTTGTTTCGACTCCGAACAGTCCGAACGCGCGATCTTATTTGTACCCAGAATCCGACCTTCCAGATTTCCAGTAGCTGCCCGGAAAAGACGC
GGCTGATGAAAGCCCTGGATCCACTCGGTGCGGAGaacggtggtggtggttgGTATCAGCGGAGCCTCAGTGAGATCTTGGTCTTCCGTCGTCTCAGCAC
TCACATCGCCGACTTCGCCGATCTCGACATCTTCGTCACTTGGTGCCGTTGATCCTGCAACAGATTGTTCGGCGGAAGCTGAGCTGCCCGTCGACGATCT
ATGAGGAGAGTGTTCCGATAAATCGCCGGACTGGTCGAAATCAGATAGACCATCagatcgacgagaagaaggcgccaATGACGGCTTGGAGACCGCG