Description :
From Genome Similarity Track
Location :
Scaffold_255:45- 1586
Sequence
1541 bases(100 bases per row)
AACAATCTTCGCGAGGTTAAGGCCTTCGGGAGAGTGGGCAGCGGTACACAGGCTACGAAGCGAGCTTCACTTTGCGCTAAGTCAAGTATGTTGGGGAAGT
TGTGGCAAAGTGGATGGTGTGCATCGACCCAGAGACGGAGGTATTGTTCGTATCTATATTTTTTCGAGGGCTTAGATGCTAACTTGTACAACTATGCACC
TTGTAGATCTGCATGCACAATCACAGGACGCCAATACCATCTATGAGTTCTACAAGCGCGGCAAATCCCTGTCACTACCAGCAGCCGTTCGCAAGGACCT
CGGTCTCATGGCCGAGGTGCAAACCAGTACGCCGGCGATCAACCGGTACCTGTCGGACAAGATTGGTGGGTGTTCTTGGTGAACGCTATGCAGTTGTTGA
GTTTTTCAGTGTTCGTTTTGTAGTGGTTTTAATTTGAATTGGTATTAACATCTTTGTATTTGGGTTGATTAATATCTACAGGTATGGTCATCACCCCCCA
GCAAACAAGAAATATCCTGCAACAAGTACTAGGGTCTACGACTATCGAACGGACCTGATTGCTGCTTGATACGTTTGCCCGTGTCGATGATCATGACGTT
CTGCTGGTGCAGGATCAGATGGACATCACCTACGTCATTGCGATGCAAACCGCAGTGCAGAAGACGTGCTTCAAGCAATGTGCGATGGTTTAGTCATGGA
TTGGACACACGGGACCAACAACTTAGGCTACCATCTTGGTTTGAATTATCTCTTAGTATTTTCTATGTTACTAGCTATGATACTAATGAGATGATATTGC
TTGTCAATCATTTGTTGAACGCGTACGAAGTCTTGTTGTGACGTCGGCAACTGGTAGAGGCATCCCTGTGGTTGACCTTCGCGCGCTGGACCAGAAGGGC
GGGACCATGGAGCGCATTTTGGAGTTCTTCAAGCGGCACAACCCGTCATGGACATCAATTGAGACGTTCTTAATTGATATGGATTTTGTGGAGTGGCGAG
TGCTGGAGAGAGTGTTTTCTGACGCCAAGATTCCTTGTGCCAATTCCACGCCCTTACGTACTGGAGGAAGGTGTGCCGAAGACCGAAGTACAACCTGACG
ATGTCTCAACGCGAGCAGATGGAGCATGCATTCGGAAAGCTCATCTACTGGTACGAAAAGATTGAATGTTCAATGTTACCTGCTATTTTTACTCAATGTT
GTTCTATGTTATTGTGTTGCCGACTGTGTTGCTCGTTGGGTTGCTCTGTATGTTGTTTACCAACAGCAATACAGAGCGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN