Description :
From Genome Similarity Track
Location :
Scaffold_5937:45- 1384
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_5937-snap-gene-0.1P-type ATPase (P-ATPase) Superfamily

Sequence
1339 bases(100 bases per row)
TCTCGTTCATGAGCGGATCGATGGCATTCGCCAGGCCTTGACGCCTTTTTACAAGTTCCTCGATGGACGAACACGCGAGCTGATATCGCTGGTTCCACTC
GTTGTAAGTCGCGCGGTCGATTCTCTTGTATGCAAGACAGAGTGTGCGCATACCGCCTTTTGCATAGGTTGAGAGCTGGTCGTACACGCGGTCAACCATG
GCGGACTGTCCATCCGAGATCGCGAGACGCTCAAAAATGACGTTGTCCGCGCCCTTGCACAGCAACTCAATCTCTCCATCCGGAGTCTCGACAATAACGG
TCATCCGCTTGCGGTCACTGTCAAACTCGAGAACGTTTCGGATCCGGTACACGGATGGCGATTCCTCTTTCCCAGGTTCCAACAGTGTCATGGTGGTTGG
GGTCCGATGGACAAATCGTACGTTGCAGAACGCCGCCGCGGACACAAGAGCTTGCTCGTCAGGTGAAGACGCCGAATACTCCGGTACTGGAGCCGCACAC
ATTTCAGCGAATGGCTTTGCCGGGATCAATGTGTGGCACAGTGCCAAGTGGCGCAGGAACAATCGGATCATAGCTGCCTGCGGGCTGCCGGCTTGGAGGT
CGGCAAACAACTCGGTCGGGTCAAACTCGACAAATCGTGTCTCCGAGCCACCATCATCGAACCCGGCTTCGATGTCGTCAAGACGGATGTCTCCACCGTA
GTGCTTGTCGCCAATCATGCAATAGCGAAATTGCATGAGGTTCATCGTGAGTGTCCCTGTCTTGTCGGTGAAGATGTGATGAACACGTCCTAAATCTTCA
TTCAGCGCCGAGGATCGAACCATCGCGGGCGTGTCGGAAGCCTCGTCGTACATCTGCAGATCTTGCTGCATGTAATACGCTTGCCAATACTTTACAAACT
CCAGCGACACGTTGAGCGAGATGGGGACGAAATTCTGCATGATGATGAAGTACCGCACGTGGAGCTTGACCAGTTCTTCGTACGGAAACGACATTCCCTT
GTTCCACTTCACCGACGTGTGGACATGCGAATCGAGATACCAGTGGGGGTCGCCGTTCGTGATCATCCAAAAAGCACCAAGGAGTGCTCCAACACCACAT
ATGAGCTGTTGGATCAGCACGACACCGATAATCAAACCGTTCAGACGATTCTCCACAGACGATGACTTGACCACAGGCTCCGAATTGCTGCAGAAGACCT
TGGATTCATGACCCGTGAAGATCACCATCCCGATCACCGATTTGGTGTTGCGCAACACGCAACTTCGTAAGATCATTTGCTTCGCAGTAACAGGAAACTG
GAGGCCGATTGACTCATCCGCACGGGTCACCATCTCGTA