Description :
From Genome Similarity Track
Location :
Scaffold_552:45- 1291
Sequence
1246 bases(100 bases per row)
ACCTGAGATCCATGATCTTCTCCACTTCATACTCGTCATTCTCGTTGTCCGCTGCCCAGCTGTCTTCGGGAAGAAGTGCTGTGTCAAAGTCATCGTTGTC
TTCGATCTCCGGTTGGATTATAGGCCGTCTGGGATACAACGCCCGGGGTTTCAGTCGACTGATGTGAACCCAAGGGTTTACACGGTAACCCGTGTCCTCA
ACCTTGAGCCTCACCCGGAACTCGTCAACCACTTCGGCGATCCTGAATGGACCATGCCATAAGTGGGCCAACTTTCGACTCAGACCCGGCTGCACTTTTG
GGATGTACAGCCAGACTGCATCCCCAACGTTGAAACCTGCCTTGAGCCGGTCTGACAACTCGTTGCACTTCCGGGTTTGCTCTTCCGAGCGAGCCCGTTT
GGCCTTCCTCTGGAGGTCTACTGCACATGCCCGAGCGTAGCCGTAGTCCCGCTGGAGTTTCCTTCGCCACTCATACGCGGTCCGTTCAGGGACACTGGAG
GGTTTAGGCCCCAGCATAGCTGAGATCGTACTCTTGGCGTCCCAACCGTGGACCAGGTAGAATGGGGTGTCCAGCCGGGTTGCATCAAACGACGTGTTGA
GCGCGAACATGAGTCTCTCTGCGGGGTCATCCTAGTCGCTCTGGTCAGCTTCTGCGATGTAAGTCCGGATGGACCTCGCCACAGTCTGGACGGAACGTTC
CTGCTGTCCATTCGCCTGGGTTCGGTATGCCAACGTAGCTCGCTGTCGGCTACCCAGAAGTTCCCTGAACCGAGTGAAGACTTCACTCATGAACCTGGGA
TCCTGATCGTGACGCAGTAGGGAGCTGGCTCCGAAGCAGCGGAACACCCTCTCCTCATACGCTTCAGCGACATCCTGACCGGTGGTAGAACTCATCGGTT
TGCACATAACGAAACCCGAAAACGCATCCTGGAACAGGAGCAAGAACGTGTTACCCCGTTCGGACTTCGGCAAATGGGTCATGAAGTCCATCGAGACCAC
TTCGAAAGACTCTCTGGGCTCGATGTTCCCGGGCGAAGGTCCTGGATTCGGCGGACGCCCCTTGCCACTGGCGCAGTCGGTGCACTACTTGACGTATCTT
TCAACATCTGCGTACATCCCTGGCCAGTAGAACTCCAGCCGGAGTTTCTCGTGCGTCCGGGTTATTCCCTGATGGCCACCTTGGAAATCCTCATGAGCGT
AATCTGCAACATGTCCAGACGGAGTGCTTCCGGTACGACTAGGCGC