Description :
From Genome Similarity Track
Location :
scaffold_38:44997- 51685
Transcript NameFunction/comments
Pl_111460hypothetical protein PHYSODRAFT_533592
Pl_111461conserved hypothetical protein
Pl_111462hypothetical protein PHYSODRAFT_566494

Sequence
6688 bases(100 bases per row)
CGCAAATCCATGACCTTGTTACCAAACTCGTGGAATCCCAGCCTAAAGCACACAAACATGTCGATTAGGAAAATCATCTCAATCCAGAAGATGGTAATAT
CAATGGCCTTAGTCGCTGCAGAGGACACGGGGAAGCAGATTACTGAAACCGTCAGCAGACATTGCATTGTCATCGCAATAAATACCCAAGTTTCCCACGC
AACCATCACCGCCGAGTCTGGATCGAACACGAGCTCAGAAAACCTAGCAATAATAAAAGAGCGATTACTTGAAGCTGCTATGCCGGTGGATATTTCGGAT
GCCTTGAGAAATTTCGGGTCCAAAAACCGTTTTTCAAGTGCTTCTAAGGCATCTGGTAGTGAGGGAAAAGACTTTCGCATCAGTTGAAGATGTTCTCGAG
ATATGAATAAGACGATACATCCGCTGATTGCCATCACACGTTCTGAATAGCTTGGAGAACTGCTGTCGAAATGCAGTGCAGCAGTCCCGATAAAGCTCCC
TTGTGGGATACTACGAGGTGCACCTCCATTTAAAATCACACAGAGCTCTCCTTCTAGCAAGAAAAATAGCCCACCCGCAAAATCACCTTGGCGGTATACA
ACTTCACCCTGTCCATAAAGGATGAATTTGACGTTTTCGATAAATACCTGCTCCAACTCATTTAGTACAGGCCTAACCCCCGCCAATAATGCCACAGTTT
GTAATGCTGGCTTGCATATGCTCTTCATTATGTCGTTCTTGATCGTTGTAGGGAGTTCTTCCAACAACGACCCAATGACAGCTCCGCGGTGAGCAGACCA
CCAATAATCAAGGAAGGCACTTACACGCTTGTGAATTGACAACGGGGCGTTCTGTCGCATCAGGAAAAGTTGAATACGAGTTCGGTTGCTAAAAAATTCT
TTTTGCTCGAAAGCTGAGGCAGTGAATCGCTTTTGGACATTATCGACCACAATTGCAGTGATGAAAAAACCGCTTAGCATGAACACAAGAGCAGCACCGA
ATTGTGTGTCGCTGCCCGGTTCAACTGGTCTACCAAGCGCAGTAATCACATAGCACGCATAGTACAATGATCGGAAATATTGGTTCAACCCAACTTCAAT
TATCTCGGAAGAACCAACTGCGTAAGTATTATTATCCGCATCGATATAGTAGTCCTCATTCAGCCGGTGTAAATGTAAATCGCTAGACGGGAGCCATGCA
TGAGGGCTTGAACTATACCCTTCGAGGTAAGTCATGCTGAAGTGCAAGCATGCAACAGTGTGGTAGAGCATAATCATTATCCAGCCAAATAGTAACAAAC
GTCTTTTGTTGTCAAGATGCAGAAACTCATCTACTTCTTTTACGTGATCCAGCACTCGCCATATTCGTAGCAAACGCAAAAGACGAAGAAATTCGGATCC
CATTAACCACTGTGGTAAGGCGCAAAATAGATCGAAGGCAAACTTTGTTTTCATATATCTTCGCGTGGTACGGGCTGTATCCCAAATTTTCTCTGAATTT
TCCACATACGACAAGTTAAAGTTAAGGTAGATATCGATCCACAACGCTATCTCCATCAACACATTGAGTATAGTAATCAGCCAGTTCGGGTGATTCAATA
CTTCGAAAGCCAGCCGTGTCGGGATAACAAACCAAAAGTAAACGAGATTTATTTCCAGTGCGAGAATCCACCACATCCGCCGAGTCGACTCGAAATCGAT
CGCCTTGCGGAGCAATAGCACAGACCAAACAGGGGCTTTGGGGTTTCGCTTCCAATTCAATTGTGCAGCGACCATCTGCATTACAGGTGGCACCCTCAAG
CTAGTTTTCCTGCCCGTCACCACTGGTGAGTAAAAAGGTGCCACAATTTCGGCTTGTTCGAGATCTGCCGACTTTTTCGTGCTGTCTATCTGACAATTAC
TAGTAGTAAGGTCTGGGGTGGTTACCGAAGAATTGTTTGAAACTGGCAGCGTAGCTTCACTAGGGATTTGGGAGCTTGTCCGGAGCTTGTCTTCAACTGG
TAGAGTCTGAGAATGGTTGGAAGTGGAGACTGGTGTCCTCGAATCGTTGTCAGGAAGCTGATGGGACAGTGAATGAGTGGTTACCGACAAATTTGAATTA
GTTGGTACTCTGCCATCATTCATACCTGGTGCTTGAGTAGGCACAGTGAGCTCTTTTTTCGGGACTGCATTTGCTACCACCCACCCTAGTGACGGCTTTG
CCTTTTCATTTTGTTGTAGGTGCTTCCGAAGGAGCCTTGATATCGTTTTCTTTTTTCCAGTCGTTGTCAATTTCGCATCTGGGAGGTCTCGCGACATTCC
GCTAAACATTCTTTTGGTCATATCCTCAACCTGCTTGGGGATCAGCTTGGCATACTCTGGGTAGCCATCGAGTACTCGCTCGAGATGAAAACGCGCGAGT
TTATACAGAGTGCAATACGTCGCCGTCACAACCGTGGCAAAACGAGTGCGGTTGAGAAAGATACCAATTTCACCGAAAAAGTCACCTTTACGTTCCTCTC
TCACCTTCACACCATCCATCATAACGTGAAGAACACCAGAATTCACGAAAAACATTGCGTCGCCTTTGTCACCAGCGTGAAAAACCACAAAGAATGCTGG
TAATGAAATCATTTCAAGCAAGCTTGTGATGGCGACGATGAATTGATCGTTGCATCCCTGAAAAATGACGACTTTAGCCACACTGTCCTTCATCAGAGCA
ACTTGCACATCTTTTCGGATTGACGGACACAGCAACCGCATCGCTTCACGGTCATTCGACTCTGCGTATGTGTAATAACGCTTCAAGTATCCGACTGCTT
GGTTTTGCAGTTCCTCGGGCACATGATGAAACGAGAGTAGATGTTTGAACTGGTTAATTCGTGCTTCAGACGCCTCGTTCTGGCTTTCGCACTTGGAGAT
CATAAAGAACGTGGCACAGAGGTACGTAAAGAGCAGAAACCCACAGACGGCCACGAATATCGTGAATATAAACGCCAGTATTGTGTGTGGCAACTCGCCT
TCAAACAACCCCGTCATGACTCCAAATGCCCAGAAGATCGACATTAAATACTTGGTTCGTGAGCTTTGTTCGTGGTCTGGCATATGTGGCAACCAGTGAT
TTTCACCATATTCGTCGTAGCCAAACAGAAAGCGAACGCAGGCGATGAAATGCGACAGCAACAGAATTCCCACTAGCACCTTGAACATCTTTAGCACCAC
AAAATACTTGGCATAGACATCGTCCAACTGGGCAATGTACTTGGGGATCCTCCATACTCGAATCAGCTTGTGCATCTCGTAGAATGCAATGGATACAGAC
CTTCGTACTGGGAATAGCGATATTGGTACTAGTGCTGCAATGTCCAGTATAAATCTAGGGGATTTTACATATCTCCGTCTTGACTTTCTAGCGTCTCGAG
TGACGTCTCCCTCCTCGTAGAAGCCTGTATTGAGTTCCACATAAACATCAGCCAGGAAGAAAAGCTCGCAGACGTAAACGAGAACCAGCTCAGCTGTGTC
TCTAGTAACGGAGTTATCTCGAAAGACTACGAGGTATGGTAGGATGGTGATCTCGTAGAGGACGCAGACCAACAGCAGCTGCTGCCACGCATGGACGAAG
GTTGAGTTGGGATCCAAGGCGTTCTGCACCTCGAATAGCAGCAGCTCGACAGAGTTCGACCGTGGTCTTGTGAGAGACGCTCGAGGAGGCGCTGAGCTGA
AGGTTGTGCTGCGGATGTGGTCCACCGCCGACTGGACGGAGCTGCGGCGTGCCTGGAAGCTTGAATCCGCCATGATCAGTTTACTCGTCTATAGATAGTG
AGTGAGGAAACCAAAATGCGCACAAGAGTGATGGTCACTTCAACTTGTAGGGCAACTGAAGCGACCATCACTCCAGTGCGCAGTTTGGTTTCTGGTTGGT
GTATTGGGCATTGCCTAATCCCACACACAATAACTGTATTATAGACGCAGCTAATGAGGCCAGTCTACTTCCAAGCCTATACTTATTGCTGCAGTGTAGT
ATCTAGCCTACCTACGACCAAGGTGACGTGCGTCACGAGGACTGCAATGGGTCGATCACTCAATCAGACATTCGGGCATCTTGGGCGTGCCAAACCATTT
CGCTTACGCGTGTCGGAGAATCCTGATTTTCTCAATTCCATACAAACATCCAGTCATCGTCATGTCTAAAATCCACAGTCACCGACTTTCTAAGAGAAAG
AAAGCCAAGCGAGAGCTGAGAAGAACGAAGCCCCATCCGTCAAGACGCTCTTCGAGTCTCTTGCAGTCGTCCCATGAACGAAGGGCTCTCTCCACCAAGG
AAACGCGCGCGTCTCCGCGCTCAAGACGAGACGACATCGTCTCCTGCCATGGCCGCCGACTCGGAGGCGCTACAAGATGAACAGGAACATCGTGGTCGAC
TTGCCAGGTCGTCCTTTCTATTGCTAGCACGCGGACGTCTCGACGCGCAGCCTCCAGTTGAGTCGCTGGTGGACCCGGCGTCTGTCGAGGCGCTTTCGGC
CGCCGCTGGGGCCTTGGAGGCACTCAGTAGCAGCGTCGTCCCGCCGACAGTGGACGAGCCGATGCCGATGGCTGTGGCTGTGGCGGCGGAGGAGTCTACG
ACCGACGACGAGGAGCTCCAGCAACTTTCTATGGTCAAATTGGAGCCGTCTGGCGCCGTCATGTGCGCTCCGGACGGCTCAGTGGCTGTGGAACTCGAGT
ATGAGGACGTGGTCAACTTCCTGTTTAATATGGCGAGGGAACAGAAACAGCAGCAGCTTCACAAGGGCATGCGGACGGTCCGGAAGGCCCGCAACGCTGA
TCTATTGCTACCCAGACTCGTGTCGGCCGAGGACGAGACGGGCTTGACGCTGCTCATGATCGGCGTGCGCGGCAACGACCGCGTGTTCTGCTCCATGCTG
CTGGATGCAGGCGCAGATGTCAACTTCAAGACAGTACGTGGTGTTGGTCCATTTTGGCGCTAGTGACGGATTTACTAACGGTTATAATGTTCTTGTTGCG
TGGATATTGATGTCTCTCCCGCAGGAAAAACGCACTTATGCTCTGCTGCTTGCGGCGCAGAAGGGCTGGGAGGAGATGACGAGCTTTCTGCTGGAAAGAG
GCGCTAACGAAGAGTCGAAGAACATGGCACTCATCCCAGCAGCCCACTTTGGTCATTTGCCTGTCGTCAAAATGCTTCTGGAGACCGGAGGCAACCAGAA
CTATGCCAATAAGAAGGGCACGACCCCGTTGATGCGCGCGGCACAAGAAGGACGCGATGCCGTGGTTAAATTCCTTATCAAGAAGGGTGCTGATACTTGT
GCTGCGAATAATGAAGGTATGACGGCGCTCATGCTGGCGGCTCAGCGCGGCCACGCGAATATCGCCACGACGCTTATGAAGTCGGGATCGAATGTGAATA
AGCAGACTCGACAAGGTAGCACGGCACTACTACTTGCTGCCAAGCGCGGTCATACTGCTGCAGTAGAAGCTTTGATGACGGCAGGTGCAGATATCTTCCT
CAAGGATGATCGCGACAAGACGGCAGCCGAGACGGCGCAACGACGAGGACACGTGGATTTGTTTTTGAAGATTTCGGTGCAGAACCAACTTCGATTGATG
CGCGAAGACCTCCGACGGCAGAGGTGTTACATGCTAATGCGTTTATCGACGCTGTATGTCCTATCGCGCGTGGAGCTGAAGGCGGCGTTCAAGAACCAGA
AGCGGCAGCAGTACAATGTTCTGATGGACAGGACGCTACGTCTGCCTAAGCCGCTGCTGCAGAACATCGCTCTATTCCTACCATTGTGCCGCATGTGGGA
TCGTCAACTGCGCTATCTAATTTATGAAGCGGCGCCACAGCCTAACCGCGTGGTGCAACAAGGAATCCGTATTCTGGACGAGGTGCTGCTGAGCGTGAGT
CTGGAATTGCGGCCAAGTCTGCATCGTATCAAACAGGAGTGCGGCGGTCCGCTGCACGTGACCGGTCAGCTCGGACTGCTACGTGACAGCCCGGAATACC
GCGGACTTTTCACAACGGAGTCGCGGACACCAATGCCTCCACGCATGCTCCACCAGCTGCGACGCATGGCCGACATCCAAGGTGCGCTGTCCACGTATGC
TGCTGGGTCGGCAATCCAGTTTGGCGTGGAAGTTGCGCAAGACGTGGTGTCACTGCTCACGGATCTGCTGAACTGGGATTCTAGTCGAAGAGAAGCCGAG
CTGTTGAATTGAAGACAGCGCAGTAATCTAGTGTAAGTGAGGACGACGTAATTTAGAGCAGGATGAAGAGATCAGCAGACGTCAAAAAATCAATGTTTGT
GCAGTTATTGAAGCCTAAATGTAGCCATCTCACGACGTGAATGCGAAAACAGGCGGCATCTTGGTATCTCGCGCGTAGATTCAAACGGCGATGGAGTTCC
TAGTGCACAACATCTCGCACTCGGACCTGGTAGTAGAGCTCTCGTGGCTGCGTGAAGACGGTGCGACCGCCAGCAGCAACGGCGCCACGGTGCCCACGGC
TCGTCAACCGGTTGCGACCGTGAACGTCGACGGCGCCGCCGTGCCGCTGTCCGTGCTGGGCCGTCCCAAGTTCAGTCTGTTCCAGCAGACCAGCCAGCAG
ATACTGGAGCGCGTGCAGCAACTCCGGCACCCCAAGCGTGAGTCCACGCGCGCTGCAGCGGTGCTGAGCGTCCCGGACGCACAAGAGG