Description :
From Genome Similarity Track
Location :
Scaffold_145:44990- 47573
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_145-snap-gene-0.44SplA/ryanodine receptor domain and SOCS box containing 3
Pytap_DAOMBR444maker-pag1_scaffold_145-snap-gene-0.32Hypothetical leucine rich repeat protein

Sequence
2583 bases(100 bases per row)
TACGTTGTTTACGTGTAATATGAGAGTGTTTTTCTGTGGCTGTTCACGACATCTCAAaTCGCCCACATGCTGGTCAGCATAAccttACCTTCTGGCAAGA
GCATTGATCCGCCCGCGTGCAACTTAGTTGGTTCGATGATCATATTTCACCTATCCTCATTGATCGAGCCTGGAatGTATTCGTACATTCATGCCGTAAT
TCATCCCGAAGTTCGAACAACATTATTCATTATGGCTTGCGAGGATGGTATCTTATAGTTTTGtAGATTCAACAGCTAAATACGCGACTCAAAGTCAATG
CGACGCAATGCAATCCATTGACACTAACGGCGCAGCTTCGTCACGATAACGGAGCTGAAGCAGTTGAcAGAAGGCGAATCTTTTGtCCGATGAAGGTGAG
cGAGAACACGGGACAGAGTCTCTTCGCGGGGATGTGAGTAAACGCGACACCAAGGCTGCGGCCATTCTtGTAGAAAGTCAGATTGCCACGCTCCATGTCG
AGTAGAACGCCGACAATATCTCCATCCCGGAATGGTTCGGCGTAGTAATCGATAaTATCATGCAGCTTGTGACCAGTTGCACAGGAGATGCCCCAAAAGA
TACCTCGGCTGAGGAGGCTACCGGTTAAGGGgATATCAGGCGAGCCGACACCAATGAAGACGCCCTCGCCTTCACGTGCACTCTCCAGCTTGACTTCCCA
ATACTTGACACCGATCGAGATCTCCGTGTTGCCCACAATTGATGCAATCCCTTTGCTTACTTGCACAGCGGCAGAATACTTGTCTTGCAGCATGATGTAG
TATGAGCACCTCTTTGcgTCGAACCGAaCGAGTGACGCCTGTAAGACTAAGATCGGGTGCTGAGGCCCTGATCCAATCATGCAATCGCCGATAGTTGAGC
CCGGTCGGAGTTCGTGCTTGCTCACTGAATCCGCCTGGACcAAcGTGATGGCgACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGTAG
AATGTGAaTTCAGGAGCTTCAGCGATCTGGTTCTTGGCCAAATACGCAACTCCCCACGGGAACGATACACGGCTGAACCCCTCGCGCTCCTCCGCCCCGT
CACGCGTGGGACTATCTTGCCTGTTCCCAGCTCCACTGTTGCCCTCCAGCAGCGAACCGATGCCGAAGGGCGTCGACACGAGCAGCGCATGaGTCATCTT
gaCTTGCTTTGGTGCGTTTCCTTGTTTTCTGCAGCCGAAAAGCGACATGGAACAGGTTCCATCGCACTTAGTGGCATATCTACAGTCCTTCCTTCGCTAC
AAGTTCAACTTCGTCAGGGACCTGTGATCTTCGATACTGAAGAACAAaCCcGTCCcActccgaCTCCGATATACCTCTCTTTtAAaTCAAaCCTCTAAAa
TCGCATCTGACCACCCTTTCTCATCTCACCCAACTGCCTTGTTGAAGTGAACtCTTCAGGATCCAGCGAAATTtACGCcTTGgTCACCTCcTCCAAGGCA
GCTCTATCGGGTAATTtAAaCGGTAAACTTCGCACAAGTTGCCGTTCGAATCGTGGCGTCGCGCCATTCTTCTGAACGCCGCTTCCCCGGCGGAAGCACG
TAGCCACCAAGGGAAACCTCGAGCGCCCGGACGCTCGCGACGTAGCCGCATGGGTGCGGCGTGCTGTCGCTGTCAGCAGGTCGCGTTCGAAGATGACATG
CTACGCTTCTCCAGTCTCAACTCGAGCCAACTCGCTGTGGCGGTCGCGACATCGGCAGCTGCAACGACCTcGTCCCGTGGAAATCTGCGTGCTCGCGCCT
CCTCGCGCTCTCGCTCGCGTCTACCCAGTCGCCAGTCAGTGACCATGAATCACTCCCTTGCGAACTAcGTTTCCTTTCCATTTCCATTTGCAAGTAAGGC
TGTGATGAAGACACCCGAGCGTGCGACAAAGCGCAAAGTTGGTTCAGCGTCAAATcGTAATAGCACCAGAAGCGGCTTCAAGACGCGAGATAAAGCGAGA
CTGCAACAGCAGCTGCAAGAGATTCTGCCGCATGGACTGGGTGACCATTTTCGGAAGAATCAAAATGGTTTGATGACACCGCTGTCTTTGATGGAGCTCA
GTGTACGACGTGTCTGCGCTAGTCTTGTTGCTGATCCTGCGGGAGACATGCCTGGAAATCCGAATCATCATCCAAGTGATATTCCTTCAGAGGtcGCCGG
GGCTTTGCTCGGATATTTGAAGCGGCATGAGGCGCTGACCAAGGATCATTTTCGCCTTCTGGCGCGATATCTTTTCCACGAATGGGATCTTTGCGGTCAA
CTTGAAGTCGATGACTCATGGTTTGACGATGTCGCACTCGCTGctcTTTACCACATCAAAAGCATCAATCTCAAAAgCTGCCCGAACTTGACGTCTCTGG
GGTCGGATCGTTGGTTCCAAGTTGACGAACTACCAAATCTGACCTCTGCTtCTTTTGAGGACTGTGTCaGGCTGAACAAAaGCGTTCCTGATCTTCTCCA
AAGCTCAACAAGACTTACTTCATTGAATCTATCGGGATGCCGTAATATCGATGACCGAAGTCTGCTGGCgCTTCGACGACTaT