Description :
From Genome Similarity Track
Location :
Scaffold_1961:4499- 5898
Transcript NameFunction/comments
Phyta_totarag13930hypothetical protein

Sequence
1399 bases(100 bases per row)
GCTGTAAAACGAGCGAGGCATCCAACATAACGGATGGAATGCTACCTCTTGCCCTTTGATCTTGACTTTTGATGGCACCCGTGAGTACACCGGTAGGTCC
GAAACGCCCATTTGAAGCACGTAGGAATAGGTAGCTTGCTTGTCCTACACATCAAATTTAACAGTACAGTTAGCATACATAATTAATCTTTGCCAATAAA
TCCTGTGTACTTACTTGTTGTAAGTTTCTGCCTTCTGTGAGTCCCTCGCCCGATAGTGGACGTGGAAATCCGCCTCGTAGCTAGCAAGTGCATCTAAGAC
CAGTCCCCATTGTGGACTTTCACGCAGCGGGAATGGCGGCAATAAATTGCACGCTTTTTTCTGCATTTTGGACCATAGTAACGCGTTCCTCCAAGGTACA
GCTTCGCCGCTGCTGAGGAACGCGATCGTTCATGTGGTCACAGAAAGTATCTACAAGAAAGTATGCATACCGTAAATTATTATCACGACCAGGAACGCGT
CAGAAGATACATTTAAAAAGATaacacaaaacaaaaaatgCACAGTACCTGGCCATGCAGTAGCTGCAGGTTTAGCAAGGGTTGCCGACTTAGAGCGCTT
TGGCTTGGGCATGGACTGTGTCGGTGGCGAACGCTTCCTTCTAGTTGCGACGCCTACAATGTAGTCAGAGATCAGCCAGGCCACAATTATAGCTTAAAAA
AACGAGTACATTCAGAGTAGTCCAAGAATGGAACCTCGAATCCTGAATCAGCTTCATTTCCATCATCAGTACCAGTATTACTGGCCACTTTGCTAGCATC
GGCATCACCTTCACTGTCACTAGACAAACAAATGACTTGGCTCTCCACAAGGCCGGGATGATCAGTTCTGCTGTCGTTGTGCCCGACTACGCCACGGGTA
CTTGCTGGTGcggctgttgcagcagcagagtctgcagcgccttcatcggCGATCGCATGCTAGCTTTACTCTACGCAGCAGCGCAGATTATGAACTAGCG
CACAGCCAGCCATTAAAAAAACGCTGGCGTTATTTTACCAATCTAACGTTTTTTTACATAACATTGTGTACGCAGTTATGGCGCTTTAAGCACCTTTTAC
GGATTTTGTCGCGTTGTAATAAAGATGAAGTAACGACTTCGCCTGCATACAAGGCGGTGTTGCCTGTCCTGTCGTTAGTACGCGAAGCCGTCAGTTTGTG
CGGCCAAACCACGTTCTTGCAGAAACACAGGGTACCTCGTCGTCAGGTGAACAAACGGATGGTTCACCATACGGCGATGACTTCGTGCATACGAAATTCA
GCTTCATAGAGAATCCACCAGGCTCTCGTATAAGGGAAACTGTCAATTCGGGGCCGTTTGGTCAATTCAAGGCCGAGGTTATTTTGGCCAGTGAGTAGG