Description :
From Genome Similarity Track
Location :
Scaffold_162:44989- 47903
Sequence
2914 bases(100 bases per row)
TCTCAGCTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGTAAAGAAAACGCAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATC
CCATAAGCTCGAATATATGCTTAGGATACGGAACCATTCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGAC
GCTCAAGCTTCACCACCTGAGCTCTTCGGAAGTTACCGAGAGAGCAAGAATCCCGCCCTACCGACGGGTACACAAGTTGAGGAAGAGTTTCAGCAGAACA
CGGATCATCGGGGGACCCCCTCCGTTAGTTGGTGTCTGGGACGCAGTTTGCTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCAC
AATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCG
ATGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATC
CGGATCTAGAAGAGAAACCTCTTTATCCTCTCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAAACAAAGAAAAGT
AAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACTGTACTTAAACCCAACCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAAACG
AGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAGGCTGGTCCGACAAGGATCTCGAGTTTGTGTATC
GCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGAGAACCGGTGAGAGCACCAAC
GAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAG
CTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCGGTGTCGTCGC
CGAGGGTCAGCCAAGCTGCATCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGG
GACATCCATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAGTCCCTGTGAGCGCGAAGGCTCGGGATCCAGTAGGCCCTACGCGTGATCTGTCACAA
TTCAGCCACGATCGAGCCAGATCCGACAAGAAGCCAGTTGGATTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCGGTCTCGCCAGTGGACC
AGACGGCCACAGGCGCTTCCGACACTTCCTCGGGCACCCTGCAACGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCC
CGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGAT
CTAAATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGG
ATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGC
TGAGAGGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTG
CGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTTCCGAAGCGTGAGTGAGCCGGGTGCTGATACCCGCGGTGAAGAAGGCGACCAGTCTCGCGGGTACACGGAAGCGCTCGCCGTGATGA
TTAAGTAGAAAATTGGAGTCGACGCCGGGATCGAACCGGTGACCAGCTACACGAGAACTCGGTACTGTACCGCTGAGCCACTCGGTGAGAAAGCCGAGTG
AACAAGTGAGTGAG