Description :
From Genome Similarity Track
Location :
Scaffold_48:449811- 457691
Sequence
7880 bases(100 bases per row)
CTACCTATAAATATACTCAGCTTACAGCCTACCTTAAATTGTTTTTTTGTCACCTCGCTCCCTTTAAGTAAAAAGGGACCTGTGAACTGCCGTTCACTGA
GAGTTTGTAAGCGCTCGGAAGCCAACTTTCTCTAGTTCAAGGTGCTGTGTGACCCCGTTATCCTTGATAGCACTCGTAATCAATCCACGCCAAAGCGGGT
CGACTACCTGAACCTCTCTAAGATTTGTTGCCTTGGATATGAACAACATTTCCCATCCGAACGGCTCACAGTTCGAGTTGGCTCAGAAGATGGCAGGTAT
ATTCGAGATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCCGCGCAGCTCGAGCGCGTCAATGTGTTTGACGCTTACGAGCAGGGTCTCATCGCG
CATGTGCGGGGGAACCTGCAGGCTCCGGCGGTGGAAGCGAATCCATCTCACCCGAAGCCAATTCGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCG
AGAGCCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCTATGGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCCTTTGCACTCTCCAACCTTAG
CGGCCGTGCTAAGGGTTGGGTGTACACACGGGAGGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTC
CCGGCGAACTTCGAGTACCGCCAGCGCTCGCGATTCCTCTCGTGCAAGCAAGGGAGGCGTGAGCTGCATGAGTACGTCCATAAAATACGGGAGCTCACGG
CGTCCCTAGTGGGAAACCCACTCAGCAAACACATCAAGATGACAGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCGCGCACTCAGCTGTTCCGGGTGCA
GTCAAACACCCTTGAAGAGGCGATTCAAGTGGCTCTTCGGGAAGAGTATAGCCATCGCCAGGCGCGTACGCCGGCCTCGCATGGCCTGGGAGTTCCTTGT
CGACTCCCGGTCGAACGAGCCCCAACGGACCAGTTCCCATTGGAACTCGGCTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCC
ACTTCAAGCGCGACTGTCCCGCGGAAAGACTCCGCAGACGATCTTTCCCCAAGCCCGTCCTCAATGGTCGCTGGCAGAAGCCAGGATCCAGGATCCAGGG
GACAGGGGAACGCCGGAAACCAATAGGTGCGGGGCGCCCTACAGGGGAGGAACTAAGTCTTCGTGAAGGGTGCGCGGGTGGCGCGTACCACGGGGGACTT
AGCCCCTGAGAGTCTTCGCACTCTCGAATCGGTGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTCAGAATC
TAGATCGATTCTGGGGCATCGAGGAATTTCGCACGCCGCCAGACAGTTGCTCGTAATAGCAACAAGTTGTCCGATGTTTTGAGAGAAAGCAAGGGCAACG
GGACAGTATCAGAGCGACCGGCTGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGATGTCAAGCTTGAAGAATTTGACAGCCTCGAAGA
GTTCACTGTTCTCGACATGGATCCATACGATATGATCCTGGGCATGCCCTGGCTGAGAAGCACGAGCCCTGGATCGGCTGGCGAGGCAAGGCAATCGGTG
CCAGCCGCCCTGCGCAGCCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGAACCCAGGGCGCTCGCAAGGGTTGTCGGGGGACCAAAGCGTC
CGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCAAGGATGTTTTGATGGTGGCAGCGCCCAGAGGAGGCTCTGGCCAAGTGGGTAACTTGGGT
CCACAAGCGGGTAACTTAGCTCCGCAGACAGCTGCAGCTATCACGAACTTTGACGATAGCGTGTTCCGGGTGGGTAACAGAGTTCCACACACGGTCGCCC
AGACCTTAACTGAAGAGGAAGACGTCGAATACGCTTCCTGTGTGGGTAACATAGTGCCACACGCGATCGCCCAGACCTTACCTGAAGAGGAAGGTGTTGA
GCACGCTTCCTGTGTGGGTACCACAGTATCACACGAGGCCACGAGTGCCTCGGATGTCGGAGCGCCGACATCCCCAGACGTGGGTAGCAAAACTCCACGT
CACGGTCGCCGTCGACGACGACGTCGCTTCAAGCGACTCGGAGTCCAGTGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCGCATCTTCGAT
GGCGAGACCGGCTTACTCGTCAAGGCATCAGGTGTCCACTTGGAGCCGTTGCCAGAGGTTGCAGAGATACCGAACCTCGAAGAAATGACGGCCGCTGGGA
GATTGCCGAGATGGGGAGATTGCCGAGATGGTGCTCATTAGACCAGATGCCACTCGGGAGAAGTTGAACTACTCCTCTGTCTTGGACGAGGACGTCCTAG
AAGATTTGAGCAAGCAGCGTCAGACGCGCTTGGGTTCTGAGTATCTTAAGGACCCCCAGGAATCCAATGAAACAATAGGTATCGGAGTATGCGGACGTGG
TGAGCAAACATCCACCGACCCAACTCCCACCGGATCGAGACGTACGGCATGAGATTGATCTCGTGCCTGGCACAAAGTATTGTGTCACGAGGTAATGGCT
TGATGCCTTCTTCGCTGGGAAAGCGAAGGCATGCATGGTGCGGGAGTCGAAGTCCCCGCATTCGATGCCAGCTTTCTGCGTTCGGAGCCCGAACGGAAAG
TGCCGTCTAGTTCATGCTTATAACAAGCAGAACAACGCGATGGTGCCGGCCCAAACACCAATCCCACGAAAGGACGTGTTGTTAAACAACATGGCAGGAA
GCGTACAGTAAAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCTTGATGCGCGAGAGCGACATCCCACTCACCGCGGTGGGCACTCCAAGCGGCAT
GCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACACTCCGGCGGCATTCAATAGCCTCGTGACGCAATTGTTCAGGCCACTGCACGCCTTCGTA
CAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGACGCAAGACGGCCATGGAGGTGCTTCTGGGCACCTCCGTCGAGTGTTGGACGTGAT
GCGAGCGAGCAGGCTTTACGTCAACATCGACAAGTGCGTCTTCGCGTCATCAGAGATTAAGGTTCTCGGTTGCTTCGTAAGAAACGTGGGCGTTCGGGCT
GACCCAGACAAGGTCAGGGACATAGCAGCATGGCCAACGCCCCCATTCCAGAAGGATCTTCGAAAAAGGTTGGGCTTGACTAACTATCTTCACAAGTACA
GTGCAGGGTACGGGGGACTCGCTAAGCCCTTGTCGGGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCAT
CAAGGCCAGCCTCCCAGAGGCTCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCGTCCAATTACGCCATCGGGTGTGCA
CTGCTGCAGGTCAACACGGCTGGACATGAACGAGTCATCTCGTTCCAGTTCAGGCAGGTCAAAGCCGCCAAACGGAACTACCCTGTCCACGACAAGGAGC
TCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCAGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCATCCTTGAGGACGGCGAC
TAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAGTACAACTTCCGCGTCGAGTACAAGCCGGGCAAACTCAACGTGATT
GCGGACGCCCTCAATCGGCGTCCTGACTACAAGTTGGCCCACATCACACGGGTGACAACGGATCTATATGAGCGGATATGCATGGCGTATCGAGACGATG
AGGCTGTCGCGCCTATCGTCAAGTTCCTCACGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTT
GAAGGATGGCCTCCTCTATTACAGGGTGGAACCCTTTGAACCTCCACGGATGGCCGTACCCAACGACGAGGATCTGAAGCTTGATATCCTCGCGGAGGCG
CACAATGCGCCCTCCAGCCGCCACTTGGGTCGCGATAAGACCTTTTGGTCGGTCTCTCAGGCCTACAGGTGGGCCCACATGTATAAGTGGGTGGCACGAT
ACGTGAAGACATTTGAAGCATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAAAGCCTGCCCGTACCGGCTGACTGTTGGAAGTTGAT
GAGTCTTGACTTCATATTTGGCCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGCCTGAGCAAGATGTACCATCTTGCTCCG
GTTCCCGTCACTGTTACGGGCGACAAACCGGAAGGTTGCTCGTCGATAGGGTGTTCGCTATCACAGTCTCCCGGAGACGATTGGCTCGGACCGAGACCCG
CGGTTCACGACTGCATTTTGAGCAACGCTGTTTCCTTTACTTGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAGACAGAGC
GCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCAGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGCGTTTGCGCTCAGCAA
CGCGGTGCACGCGTCCACGGGGCTCACGCCGTTCTACTTGAACAGCTCCCGTCACCCCAGAGTGCCTCTCACGCTTCGAGGAGACACTGACTCCTCCATG
CTAAGTGAGGGAGAGGCTCGGAAAGCCCTTCCCCCCAACCCTTGGGTGTGAGACCAGTTTCGCAGCGGAAACAAGTGGAATCCGTTTTGGATACCAAGCT
GAGCATTATCAGCAGGGTCAGCGATGCAATAGCGGCGGCCCAGAATAGACAAAAGGAGTACTCCGACAAACATGGAAGAGATAACTGAAGTGTATTTAAA
GTAGGGGAGTTAGTGTTACTAGCCACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGC
CAGACATGGTGCGTCGTACACCATCGCCCTCCCTAAGTCAATGACGGCGCACCCGACGTTCTATTTTGGACGCCTTAAGCGGTACTTTGATCCGCAGTGG
TTGCGGGCTCGCAGACCCACCTTGGCCCAGCTCCTCGAAGCGAGAGCCGACCACAGACGTCGAGGAAGGCGTCGGAGCAGGCACCCAAGCCTTGGTCTGA
ACGGCAAGGTTGCGGTCAAGACTGTACGCAGGAGGGGCTCCGTACGAACGGAACCCGGAGCCATACGCCGAGTACGTTGAGTACGCCGGGTACGCACCAT
ACGCGTACGTCGGGTAGTGCGTCGAAGGCGGCCCCGGACGTGGCAATAGACGATCCGTCGGATCATGCGGAAGGCCTCGTCCAGATCGGACGAAGAGGCC
CGGCGATCCACCCGCAGATGCAGGCTCGCGAACTCACGCTCCAACAGGTCCAGGCGGGCCGCAAGACGAGCGAGATCGCCCTGATTCCCGGTCTGGGCGG
GAGCATCACCGCCAGTCCTAAGGCCAAGTGCAATCTCAAGCACGAGGACGCGTTGACGAAGGCGGTCAACCTAGGACCCTACGTCGGACCAACAGGAGAA
GCGCTCGGTCAAGAGTAGCGTCCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGACACCTCTGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCAC
GTGGAGCGAATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACACCGAGAACTCGTGGGAGCCGATTG
AACGACTCCTGATTGACTGCCCGAAAGGTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTTCCCGAACGGGGTACG
GACGTTGAAGACACTCCTTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCACGCTTCAGGGTGTCCCTTGGCAGCATGCGCTTGCTGGAAAATTGAACAC
GAAGATCACGGTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTGAGAGACTCCACCCAAGCCCAGAA
CATGTCCCCACGAGAACGCCAGGTGGGGCATTTCTCGGGCAGAACCCAGATGTACCCCCAAAGAGGATAGAGACCACCCCGGTTCTCGGGCTTCTTACGA
CACGTAGTGAAGGCGTTAAGAGGGATGCGTGTGGCGCGAGAAGCGCGCACCGAGCCGCCTCCAAGTTGTCAACAAACAACTGTTCCTTCTGGGCAAGAAT
ACGTTCGTAAATGCCCCTAGAGGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCCAGGAAGAGGTCAGCCCCAGAGCTCTCCTTGGGAGGC
CAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAGCCCCCACGCGAACGCTGGGCAGCTTGTAAGTTCTCCTGCTTCTGGT
CGAGGTCATTAGTGATCTCCCGGGGCTCCAAAATAGCACCCTCCTCCTCATCCTATTTCTCCTCCTTCTCATCCTCTTCACCCGAGGAGTCGAAGAGGCC
CCGATGGGGGTACCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTCGAAGCCATACGCTTCTTAGAGGGCTTGGCGCCTTCGGCTTTCGCGGCCTTAGCA
CGAGCAAGTTCCTCGTCAAGCGAGAGACGGTTGCCAGGCTTACCCTCCTCGTCGACACCAGCTTTGGGAGTGCCCTTAGCCTTGACGGCCGTTATCTCAG
AGCGCACCGACGTCCTGGGACTTTGATCACCGTGATCACTAGCGAGCGACGGCACGCTGTCGTCTTTGTGCTCGCTGGGCACTGGGATGTGCCCTCCCGT
AGAGCCCACAGGAGCATCGTGCGTGCTTCCGGACTCGGCTTCGTCCTCACTGCTGAGTCGAACTGACGTTCAGCGAACCGAGGGTTCGGACGGCTGTCTG
GGGAGGCCGAGGGCGACGGACTGCGGCGCTTGCTCGTTCTCTTGGCCACAGCCGCGTCACCCGTTGAGCCGATCTCTTCGGAGGCCACCTTAGTAGCCTC
CTGGAGTGCCAAGCTTTTGCCGTGAGAATTAGTGCTCTTGGCTTGCGCCTTTCCGGCAGCAGCCCTGGAGCGTGTCTTCGCACCGCTCTTCGCAGTGCCA
CGAGTCATGACATACAGTCACAGCGGAGACAAAGAAGAGGAGCGCACAGACTGCTGCTCGAGGCTTTAACTGTGAAGTGAGCCTCAGCCGCGCTCGCGCT
GCCAAGTCGATGTTTTTCGACTTTGAGAATTAATAAAATTTTGTGACGTACACTTCTTCATTCTGATTGGTCGGTAAACCGAGCCTAAGTGGTAACGGGG
TACGTAGCCCTAAGTGTACCCCTAGTTACATGAAGTGTGACACGTCATACTTCGGGATGTTTGGTACAAAGTACCAAGGTTTTCCGAGGCCAACCATTGG
CGACTACTTGTTTGTATATTTAACTCAAGCTTAGCCTACCTATAAATATACTCAGCTTAAACCCTCCCTTTAATTGGTCACCTCGCTCCCTTTAAGTAAA
AAGAGACCTGTGGACTGCCGCTCACTGAGAGTTTGTATACTCTCGGAAACCAACTTCCTCTACTGTGTGACCCCGTCACA