Description :
From Genome Similarity Track
Location :
Scaffold_3:4497593- 4508247
Transcript NameFunction/comments
Physo_300351ras-domain-containing protein
Physo_498636Zinc (Zn2 )-Iron (Fe2 ) Permease (ZIP) Family
Physo_287117RING-box protein 1
Physo_490672PERQ amino acid-rich with GYF domain-containing protein 2
Physo_314886predicted protein

Sequence
10654 bases(100 bases per row)
ACCGTCTTGAGGACTCCGAGCAGTGCAGCGGTATCTCCGGCGAGTGCCGAGACTTCGACGTAGGTGATACCGTGCTCGCTGCACCAGGCGCGAGCAGCTT
GCTGCTCTTCGAGGCCGGCTGCGTCGATGCAGTCGCTCTTGTTGCCGACCATGACGACGGGGGTCGGAGCTTTCGGCGAGCCGGTCTCAACGCTTGCGGA
CGCGGAGATCTCCCGACGAGCTACATCGAGATACATAGGCAGCGTGCACCATGAGACCGGCTCCTGCAGACTAAACACCAGTACAATCGCCTGGGTACTG
CGGAGGTAGCGTGCAAAGATACTTGACCCCGCGAAGCTTTGCGGCGGCACGTCCCACAGCTGTGCAACAAATACAAACCAGTTAAGGCGACAGTTAACTC
GTAGCACTACTGGAGCAACCGAATGACAGTGTGCACCACCTCCACAACCACCGGCTCGTGCCCCTCGAGGCGAAGCAGCTTGGCGCCTACGGCAGCTACA
GTGCAGCGCAAGGTGCAGTGAGTCAGCACAGTTCTCCTGTCCTATGTCCAGAGGCCTCTCATTCGCCGCTTGCTCACCCGTGGTGGACGGTGCGTACTCG
ACATCGAGCGCAGTGCCGATCCAGCGTCTGAAGAGCGTCGTCTTGCCCACGGCGGCGTCGCCCAGCAGCACAACCTTGATCCTGTCTGTGGCGGACGAAG
GATCCGAGCCTGTATTTTGCGCGGCGGGCGCGTGCCTCCGCCGGCTGCTGGAAGCTTCAAGGCAATCACGGCGTTAATCGACGCAGATGGCTGCTCCATG
TTCGTTGGCCCCGAGCCGTGGCCCACGAGAGGCAGCAGCAGTCAAAACAGGCGACGTCGCCTACCTTGTGCTCCCATCGCGGGGGGGGGGGTACACTGTA
CTGGCTGGGGTCGCAACCGAGCTCACGAGCTCGGGCGCCGTCGGAAAAGTTTCTTAGTCGTGTTACGCATTTTATTCTTATCAAGCATATTTGATTATTG
AAAGCAGCCGAATCGTCCAATAGACTATCTTCAGTTTTGTCTCTAAGTAAGAATATTCTTTTTTCTCCTCGAGTCGTCAGCAGCTGGTCGCCGCCGCCGG
ACAAATGCGCAGCTCGCTGGAGAGAAGGCTGCAGCGGTTCACGCACACGAGCACTCTGCGATTTCCTCCTCCGCGCGCAAGTGGTCGACGCCTGATAACT
CACCAGTAACCGATGGACCCTGTAGACGAATTCAAACTGGCCGCAGCGCTCTTCATCTGGGCGCTGGGGCTCGTGGGCGGCGTCGCGCCGCTGCTGAGCA
GCCAGCGCGTCAGCAAGCGCGCCAGCAGCGTCCTCAACATGGTGGCGGCCGGCATCTTCCTGGCCAGCTCGTGCATGCACCTGCTGCCGGACGCGCAGAA
CAACGCAGCGCTCACCGAGTGGGGCTGCGAGCACACGGCTGAGGTCTTCCTGGCCGTCCGCACGCGCTACGACGGCGACAACACGCGCTGCTTCAAGTGG
GCCAACTTTTTCTACGGCTGCGGCTTCCTCATGGTGCTGCTCATCGAGGTGCTCGCGCACGCGCTGCAGCGGCACTACGGCAAGGTGCATGGCCACGGGC
ACTCGCACGGCACGGAGCAGGAGCGGGACGCGCTTCTGGCCATTGAGGTCACGCGCGCTGCCGAAGTGAACAGCCTTCCCAAGTCGAACGGTCACTCCCA
TGGTGGCCACTCGCACGGGCACTCGCACGGACGGGTGGAGACGGGGGCGTACGGCACCCAAGGTGAGGCCACGGAGCTGACGGTGCACGGCGAAGACATC
AAGGAGGAGCCGCACTCGCACATCCACGGCATCGTCAAGGGCAACCCCATTCTGGCGCTGGTCGTGTTCATCGCACTGTCCTTCCACTCGGTGATGGAAG
GCATGGGCATGGGCGCCTCGAGCTCACCGGCGTGGGACATCCTCGTCGCCATCTTGGCGCACAAGTCGCTGGCTGCGTTCGCGCTGGCGCTCGAGTTCCT
GCACCACAACGTCTCGCGGAAGCAGCTGCTCTCGTCGGTGGCCGTCTTCTCGCTCATGACGCCGACGGGAATCCTGTTCGGCCGGCTCCTGGTAGACACC
AACCACGCGACGCCCGCGGGCGGCGTGTGCGCTGCGTTCGCCGGCGGCACCTTCCTGTTCGTCGCCATCATGGAGATCATCCCGCAGGAGCTGCAGGACC
CGCGGTATCAGTTGGAGAAGTGCTCTGCTCTGCTTGCCGGCTACGGCGCCATGGGTGTGCTCTCGCTCTGGACCTAAGCACGCACACACACACTAAATAC
AACATTTGCCGTCGGCCAAGAAGGCCGCGTAGAGGGCTTTACTCGGAGTCGTGCAATCGCTGTCGCTGTTGTTCTCGATGGTCAGGTACGACTCGCCCTT
GAATATCGTCTCGAAGTAGACTGCTGCGTCGGCGACCGCTCCGCTGTAGATGGAATACTGAGTGTCGACGCTCTGCGTGTTGTACGCCTGGCAACTGGAG
TAGCAGCCGTTCTGTGAGACGTCGATCGTCACGTGCACCGCCTTGGTGCACGTGGAGTCCTCGCTGGTCGACTGGACGCACAAACTGTTGACTTATGTAT
TCTCGAAGACAAGAAAGCTTCGATCATCGTGGGGCATTCAAGAGCCCGTAAAGCGATTCGCCTGGCGCGAACGTCAATGCAGAAATTCACTGATAACGTT
AGTAAAAGAAGTTAAGGAGAGAAAACTTACTGAAGTAATAGTAGCTAAACCACGCCTCAAAAATAAAGTGTCTTGGGCATTTGTCTTCTCTCTCGAGCGC
GTCTCGAATACACTGCAGCAACTCTACAGTCGCCTTCACGGACAGTAGACACGCTGCCGCCACCTTGCATCTCTCGAAGCTCCCTCGTCTCTGTTTATCT
GCCGTACTTCTGGAACTCCCACTCGCGGTTGTCCAGCGGGCACACCTGGCGGGTCTTGAGCCACCGCGAGATGCAGTGGAAGTGGAAGGCGTGGTCTGCA
GCAAATAATATCAAAAACGCCATAAAAGTTAGGTTAATCTCCAGCCATCAACCCAGATCCAGCCGCTGCAAGACGTACTGCAGACGCCCCAGGCCACTGT
GCACTCCTCGCTGGTGGCCGACGCCTGGTTGGCCTGGCACTCGATGCACAGGTCCATGATGTGGTTGCGGCAGATGGCGCAGTTGTCCACCACGATGTCT
GCGCGCAGATACGTAAAACAACAATAATAATTAGTGACTAATTTGCTGAAAGATCTTGCTGGAGCTGGCCAGAGCGACGCACCCCAGGACCACAGAGCCA
CGGCGTTCCACTTCTTGATCTCGAAGCGCTTCTCCTCGCTGGCGGCGGCAGCAGCGGGCGCCACCTCCGCCTTCACCTCCTCGCTCTTCATCTCCTCGTC
CATCGCGACTGCGTTCACTGTAGCGCTCGCCGCCTGGGTTTTTCTTCCCCTTTGCGCCAGATATATCGTACTTAAATGGGAATTCGCGCTTAGGTACGAT
ACTTGGTCCAGTGTACCACATTTTTAAAGTCGGTAATGGTCAAGTTGAAGTGGACTCACAATTTCCTGCTCGTGTTTGTTTCATGCTACGGTTCCTACGC
GACTCACTAGCTCGCCACTGCATCCTACATCCCAATGCAGGCGAATTAACTGCCCACCGAGTAGTTCAGCAGTGACGGATCAATCTTCTGGCCCTTGGAG
CGACGCTTGCCCCGCTTGTTGGACGAGCCCGTCTCGGAGGCACGCTGCTGGGCGTCCTGGTGCGCCGGCGACTTCTTGCCGCTGTGCTGTGTCTTCTTCC
GCTGGATGAACTCGGTCGCGAACGCCGATACGCGGGGCGTCGAGCCCAGGTACGCCGCGAGGAACTCGCGGATCTCGCCAGGGTCCTCCACCGATGCGCA
GTATTCCAGCAGCGTCACGTTAGCGTTGCTGTCGATGGTCTTCAGCTGCTTCAGGGCCCACGCCATAAACTCCGTGGACACATTGTTAGATCCAAACGCG
TTCGAAGTGCTCACTTGAGCACTGCTGGACGAGGGCTCCTTGCCGGCGGACTGTGCTGCCCCAAAGTTCCAGAAGGAAGCGTCGCTCTCGGCCTTAGGCG
GGGACGGCTTCGCTGCGCCGTTAGTGGCACGAATCTGCTGGCGGCTCTTCAAAACGGACGCAGGCACGGGGCCCAATACTGACCGAGAGGGCTTGGGGAT
CGCAGCAGCAGCAACCTTGTTGCCCGCGACGATGTTCATCCAGTGCGAGCTGGTCGGTGCATTCTCGTTGGCTTTAGCCCGCTCCTGAGCCAGGCGCTCT
TCTTCGGCCAAAATATCGCGCATCGACTTCGAGGTGGTGCTCTTCGCTACAGTAGCGGGTGTACCCCACGGACTCGCGGCCGGCGCCGCAGCAGGAGCTG
GGGCGGGAGCAGGGGTTGGTGCTGGAGCTGGTTTGGCAGCCGGAGCCGGCGGTGCCGGTGCCGGTGCCGAAGCGGGCGTCGGTGCCTCAGCCGACGGCGC
GGCAGGCACAGCAATGGAGTCCACACCGAGCATCATCTTCAACTGTGCTCCCATTTGTGCGAGGTTGGCCGTGTCAGACTTCGCATCCCCCATCTTGCTG
AGCATTTCACGCTGCTCTTCCTGCTGGATATCCTTGAGCGACTTGGAGTTGTTGGATGCAGCAGACGTCGACCGGGTTCCCCATGCGTTGGTCTCACCCT
TGACAGCCGTTTTCTTCTCGGTCTTTTTAACTGGGCTCACATTCTTCTTCTCGCTTTCAGCAGCCTTCGCGGGGGACTTCACAGGCGACGCGTCCTTCAG
CTGGTCCTGCTGGGCACTAGTCGGGCTGTTAGTTTTGATCGGCGAACCGCGAGTTTCCTGGGCAGCTCGGCGCTTCTCTTCATTCTGGATGTCGTGGAGG
TTTGCGGACGGACGCTCTGGAGACTTCGGCACAGATCCCCAAGCATCGACCACGGGAGCAGCAGGGGGGCTTGTAGGCGCGGGGGGCTGGGTGGTCTCTG
GTGCCATCGGCCGCTCTTGCTGTAAACCGGCAAGCGAGCTAGTAGCACTTTCCAAACCAGACATTTCCGGCGCAGCATTTGGCCAGAATGCCTGGTCACG
CCGCTCGTCATTCAGGAACATCGCGTTCTGACCGATAGACTGCGGATTCTGCAGGTTAAGCTGGTGCTGGGTGCGGTAATCGGACTGGAACTGGATTTGT
ATCCCATCCGAGTGGAAGCTGTTGTTTGCTGCAATGTTGCTTTCTTGGTTGCTTCCAAATATGCCCAGTGCGCTCATGATACCTTCACGCTGACTGCGCT
GCCACGAACTCTGCTGCTGAAGAAGCATTTGCTGTTGCTGTTGCTGTTGCCGCTGCTGCTCTTGTTGATGTTGCAGCATCTGCTGCTGCTGATACAACTG
CGATTGCTGCTGTTGACGCGCGATTTCGAGACGCTGCATCTCCATGCGCATCTTCTCCTCTTGAAGCATTCGCTGTTGTTGTTGCTGAAGCTGCATCATT
TGTTGTTGCTGTTGTTGTTGTTGTTGCTGTTGCTGCTGCTGACGTTGCAATTCTAGTAACCGCTGCTGCTCCATATGCATTCCTCCAATGCCGCTCATAC
GCGCCGGCGGGGCAGCGAAAGGCATTTGGCCGGGTCCGAATTGATTCGCCAGAGCCCCGAAATTGCCCTCGCGGCCAAAACGAATCGGAAGGTGCGGCTT
GAAGTAGCCAGCCTCGAACCATTCACGCATCTCCGCCGTCTTGAACGGGCCCTGTTGCAATCCCTGGGGGTCCAAGTAAAACCATTCGTCCTCCACCTCC
AAACGCAGCGACGCGAGCCCCGGGAAGCCTTCGCCAGCAGGCATCTGTGGCAGCGAGAAACTGCTCTTCTCCTCAAGCACGAGCTGGTCGCCAGCAGGCT
CCAGCGCATCGAATAGACGCCCTCCACTCGATTGGCGGCCTAGCAGATTCGCGGCGTGGTCTCCCAATGGACCATTCGCGCCATTTGCACTCTGCTCCTC
CTCTGGGGTAGGATCATCCCAATGCACCTCTTCACTGTCGCTATCTTCAAACTGCCCCGCAGCTGCCGCGTCCTCCAGTTTCTTGTCAAAGGCATCTAGG
TCATCTTTCATCTCATCCTGGCCGATACAAAAGCCGCGTTGGCACCGCCCGCAGCACAAAATCAGCAAGATCAGTCACTGAACGCCGACAAGCTTTGATC
CGCTGCACACCACGACTTACCGGGTCGATCTTCGGTCCTTGGAGCTCCTCCCTCATTGCATCCATCTCTCGTCGGAACTTCTCTGCAGCCTCTGCCATGC
TTGACAGGTCCTGCTCAGCAACAAGAGGTTAGCACTCCAGCCGAATCCCGCGCTGACTGCAGCAAGTCCACGCACCATTTCATTGCTATCCGCGCCTGGT
TCCAGTACATCGTCCCAAACGTCGTCTCCGTGGGAAGTCTCGGTGATCTTGGCGCCGCGCTCCCACGTTGAGTCCTTCTCGTTGTGTCGGTGGTGCTCCT
CCTTCTGCTGCTTGGCTGCGTCAGCGTCGTCCCCGCGCGCGCCTCGCTCCTGGTGTCCACCACGCGCCCCTTGCGCGCCTCCAGAGGGCGCATTGCCCCG
TCCACGGCCGCGCCCGCGATTGCGGTTGAGCGACCACTGCTTGTAGATCTCCTCGTAGTCGAAGGGCAGCGTGCTGACGGGCGGCAGACTGTGCTCCGAG
GCCACCGACGTGTCCGGCGGGAACGCGGGCGCCTCGGCCGTTGTGAAGTGCAGCGCCAGCAGCTCCTCCTTCGTGTAGCGCAGCACCTTGCTCTTGCGCC
GCTCGCCCCGGTGGTCGTCGCCGCCGACGCCCGTGGCCGCGTCTTTAAAGGGCGTGGGGCCGCCCGCCCCCGACGCGGCCGACGACACGAAGCCCTCGCC
GTCCTTGGACCACTGCGGGCGGTACGCGGAGCCCTCGGACTCGGTGCGGCCACGGCCCTTCATGGCGAACATTGTGCGCGGGCGCAGCGAGATGTTGCTG
CTGCTGCTGCTGCTGGCGGCGCCGTTGGACGGGCCCGTCGGGGGCTTCTTGGCCGCGTCGTCGCCCGCTGCTGCCTGCTGCTGCTGCTGTTTCTTGCGGT
GCTTGGTGGTCTTGGTGACGAAGTCGTCGTCATTGCTGGGGCTGCTGCTCATGGCTGCGGCCGTCGGTCGTGTGGCGTGTGGCGTGGTGCTGCTTGCTCT
TGCGTTTGTTGGTTGCTCCTCTTCTTCGGGGTGAGCCGAGCGAGCGTGGGGGGAGCCCGTAGGCTTTAGAGCCAACTCGCCTAAGTACGAGCTGAAAGAT
TTTAGCCTGGCACTCCTAATTAAGGGTAGCGACATCTTGCATCTGCGCAATTGCGGCATGAGCGGCGCCGCCGGCCTGCGCAACTGGCGGTGCGTTGCGG
CGGCTTCCTCGCTGTCTTCCATGGGCTTGCTGTATTGTTGTTGTGTCGTGTCGGTCGGGTGTTAATTATCTGCCCTTGAATCCGTTGCAGTGGCGAGATC
ATCCAGGCCAAAGCCGCTGCGTCAGGCGATGCAGCCGCTGCTGAAGCCCCCGTCGACTCCCAGCGCCATGCCAATACAACAGCCACGGCTATAGCAGCTA
CGGACGGACGTAGGTCGGTAGGATCACCCGAGCAGAAGAAGGTTCTGCGCAAAGACGAATTCGGCCGCGACGTGGAAGTCGTCGTGGAGGACACGGGCAA
GCGCCGCAAGACGTCCAGGAGCGAGCGGAAGGAGGACAGGAAGAAGGACAGGAAGAAGGACCGCAAGCACACGCACAAGCACAAACATAAGCAGAAGAAA
CACAAGCACAGGCGTGGCAATAGCAGCGAGAGATCCAGATCGCCGAGTCCACAAGGCCGACTTGTCGGGACGCCGCCACCGCCGGATCCGTTCCGTCCGC
AGGTGGGTGTGCTTTTGCAGTGCTGACAGTGCTGGCAGAATGCTAATTATTATGTTGACTGTTGTGTTTTTGTTGTGCCGATAGCTGGATGAAGACCGGG
GTGGGCGTCTCCAACAGCGCCGTCGGGAGTGGAATCAAGGCCGGGGTCGAAGTAGCGGGCGCAGCAGGAGCCGTTCACGTCATCGCGATCGAAGTCGAAG
CAGGGACTCGAGAAGCCCACGCAGCAGCGGCCACCGCCGACATCACCGTCGAAGTTCTTCCCGCAGTCGTAGTAAGAGTCGAGGCCGCAATCGAAGTCGG
AGCCCGGTATCTTCGAGGTCACGTCGGCGGCGCTCGTCAGCCTCACTCGAGCGTAAGTGGACGCACAATGCCTTTGACGACCGCAGTCCCAGTCCACTGC
GTGAAGTCGATCCGTTCTACCGGCCAGAACCAGAGAAGTGGGTGTCGCGAGCAGGCGGCGTCTACTTGCCTCGCAAATAGCTCTCGGAAGCGACGTCGCC
TCAGGTCGTTCACGGCTTTCGACTGCAAGATGAGCACGCTTCTCCGTGACTGGGATGAAGGTGTGCAATACGAGACGTAATGCTCCCACTACACTCATTA
CCTACGTGCTAGACATTGATTTACGCTGTCCTGCTGTCCTTAGGCTCGAAGACCAAGCGCAAAAAGCTCCTCGAGTGGTTTAGCAGCCACTTTGACCCGA
CGTGTGACGGCGGTTGCCTGCTTGAGAGCGAATGCGGGGCAGACATCGCTCTCTTCCTGCCGCGACTTCTGTCCTGGATGCACAAAACCACTGCTAGCGC
CATTAACAAGACAGACGAGAGCGCCATTGTCGCGCAAAAATCGGGGAAAATGAAATGTTTCGCGCTTGCAGAGCAAGTCTCCTGCCTGTACGTGTTCTTC
GGGTCGACGAACGCACACGCGTACTATCGCGAGTTCCAGCACGTGGATGGGCTGCAGTTGGTGCTGAAAATCGTGGCCATAACAGGAAACGATCCTCCGA
CCCAGAAGCCGCTTGTGTCGACAACTGACCGAGAAACCCTGCTTCGTATTATCCTGCGGATCTCCAAGATGAACCGGCAGCGTAAAGAAGAGATCAGCAG
TTTAGACGGCGAGTTGGCTGTGATTCACGGGGTTTTGGCTAGCGGGGATATGGATGACTGGAAAACGGAGTCGCGAGTGTGGACACTGTGTCGGGAGGTG
CTTCTGGAACAACTCGTCGGCAACCCGAACAGCCTAGATCGAGCCCACGAGGCGATTGTATTCATGTTGAGGCACTTCGAGGTGCGCCTTCAGCTTTTTG
GAGCGGAGGTAAACTGGATTGCTGTGCCCCTATATGGTAAATCACGCATCTCAAGGATCTAACAATCAACTAATGACTTGTCGTATCTACCATGGTGCGG
TGCTAGGTTCTCCGAGAACTCATTTCAGACACTTCATTCTCCTATGACCCGGAGTATCGACGACGAAAAGAGTATGATCTTGTGCCTCTCTGCCTGACCC
TCGTCAGGTCGACCGATGTGTATCTTCAGCACGAAAGCCTCGAACTGCTTCACGCTCTGTTGCAGTCGTCGCACCTGCAGGTACGTTAACGAAGTTCTCA
AAATGCATGCCAAAGCCGCTTGGTGGTGAAAGTGAAATTGCTTGGTAATCACGCAGGAGGCCATCTGCGAAGCGCTCGTGTATTTAGTCAGCCAAAGCGC
CAAAGCGCTTGATCCGTACGCTTCTTGATACTTAATAATCTCCTGCCTCTTGATCTGATAGCTGTGATGCCGTCTTGTTTGGGTGTTTGACTTGCAGCAA
CGTAGAGGAAAGTTTTATCTCTGTCGAAGACAGCATGGAATACGAAACTTATGTTCACCTTCGTTCGGCCTTCGCACACGCATCGCAAGCTGTCAACACT
CTGATGCATTCAAACCGAAATCTGCTGCCTATTCTGGTGCGTTAGTTCTTTAGCATCGATGGCATGTACAGCTTTTTTTGCTTATCTCGTCGTGCAGGTT
GACAAATATGGTCTTCTCACGCCCCTGTCGTTCGTACTTGTGGTTGAGCGACCTCACTCGCTGAAATGGCACGCCGCTGCCATCAGCATTCGCTACATCT
TCACTCACCACTTCCGGGTAAAAATGAGCATCCCAAATGGCTCGGGTGCAGGAAAACCCGATTGGTATCACTTACCGACCGAATGCTGTTTGCGTTCATG
TTAGGGAGCAGCCTCGATCCTCAGTGATCTCTTTGACGTCCCGACGGCTGAACTGTTCCTGTGGAAGGACAAGCGAGGGGATGACGGGGAGCAGCTCGCC
GAGTTCCTCTTGGGCGACGACACGCACCAGAGCCACCTCGCGCTGCGATTTTATCAGTGTGGATGGCATCGCCCGCTGTCTCCGAGGAAGCAGTCCGACC
AGTCCGGCACCGATCGCGTCCTCAACGACATCGAGCACAATTTCGAGACAGCCGCACGAGACTACGTTCCCGAGGTGAGCACGACGTGGTGGTGGGACCC
ATTCTGCTTTAATTAACGCGCGCGCCTTGTTGACCTTCTTTGATCCTAGCTCCAAGTGCAAGCTCGAGTGGGTGAGAACGCCGACGAAGCTGGGGAACTG
GAGACCCTGGAAGCGCAACGCGAGCACCACCTGCGCATCCAGCTCCAGAAGCACTTCGCCCAGTTCCGCCACATCTCCGCAGCATCAAGCAACGCCTATT
AGACAGAGGCCGAACTAGCAATCTACGTGAAATTAATACTTCGAGTAGTGGGTC