Description :
From Genome Similarity Track
Location :
Scaffold_36:44974- 46353
Transcript NameFunction/comments
Sapdi_VS20SDRG_10514hypothetical protein

Sequence
1379 bases(100 bases per row)
CGAGGATAAACATGTCAATCTGCCGCGTGTTCTACATTCCGTGCATCAATTGCCCCACAATAGACGGGCGTATACTTCGATAAAGTCGAGGCTGAGAATA
CGCCCCGCGGCCACGCGCCAGTGCCCCATGTAGTCAAAATGCAGTCCCTTCTCGGCGCACGCCACACTAAGACTCCAGATCTAATACACATGTTGTTGGC
CCACAGGGAATCGACGAATGGCGTTGAACCTTGATGTAGCCGGCCGCATCGCCTACATTGACGCATGAGGGGATATATAATTCATCGTGTGTCGTACCGG
TGATGACGTTGTCGCCGCACCGGTCACACGCAATCACGACGATGGCCTCGCCATTCGGGTGGTTGAGGGCCACCTGCGTAGGAGTGAGTCATATGCAAGA
GTCACAGCACGCTTTTGTACGTCGTTCTTTTGGCCGGCAACGCGGTCGATGAAAAGGAGTCGTCCATCTTCGCCACCCGCGAGGATGAGCTCGAGCTTGT
TGCAGTAGACCATCGCCTCGATGCTGCCCGTGCTCTGATGCAACTGCGTCACAAAGTCGCCCGAGTTGAGATTCCAAAGCAGAATCTTGCCGTCGAGACC
TGCCGTCGCGAGCAAGCCCGGCGGGATGTACACGACGCAGAGAATGTCGTCCGTGTGTCGCTTGGTGTCGTCGGCGTCGTCGCTCGGAAGGATCCACATC
GGAAGCGGCTCGTCCTCGTCGTTGTCGTCGAGCCAGACGTAGATCTTGCGGTCCCACCCGACAGAGCACACGAAGCGCTGGCACATGTACTCACCCATGC
CGACGCGCACGTTGCGCTCAATGTCCAAGATACACGTCACTTCGCTCTGCTGGTACTGACCATGCGCCTTGCGCGGCGTCAATTGCGCGTTGGCGCTCAT
CTCGTCATCAAACTGTGGGTGCAGCGGACGCTTGACGGGGCTCGGCAAGCGCGGGCTCGCCGCACTCGCTGCGTCAAAGCGGTCGGGTAGCATTGCAATG
TCGCGAATGTGAGGCGGCCGCACGAGTGGTTCACGGAAGGCCTCCGAGTCGAGCACCGCCTTTTCTTGTTTGAGAAACTGCTTGACGAGCGCGCCGTTGC
TAGGATGATCCATCGTATTCCACAACTGCGCATTGATTCGGATAGCGTACCTAAAGTTCCACATGTTGATTTGTGCGCCGTCGTGGCTGCCAGTGATGAG
CCGCCGGCCCGCGCAATCGAACGTCATGGCCGTGATTGGACTCGCGCCGTGCGCGTTGCTAAACGTACTGATCTCTTCGCCCGTCTCGGCCTAGATAAGG
AATAAGAATTGAAGTGGATACGTTGGTGTACACTCCACGTGCGCACGACGCCGTCGTCGCTCATTTCGGCCGTGAGCAC