Description :
From Genome Similarity Track
Location :
contig_13:4497- 8903
Transcript NameFunction/comments
g2370.t1hypothetical protein F442_17851

Sequence
4406 bases(100 bases per row)
CGTATGCAGAGCCTCCTGCTTGTGATGAGAGCAGCTCTTCCACTGCCGGTGGCAAGTACTTAGCCCAGAGCTCCTCTGTGGGCTGGAGCATGTATGTCTC
GCCCTTGACGGCTCGCACGTGACCCGTCTTGCGTTCCCGCACATACACACCTTCGTTAGTGTCGAGTGGGATGGCGCGTCGGGTTTCGAGCACCTTCACC
TGGATCGGTGGGATGTATTCACGAGGACCATGCACCATCCAGCGCTCTCCAGCTTCACGCCTGATGCCATTGGGTTTCTTGACAGGAGCGGCTCCACCGT
CCTCGCCTTCCGGCTCACCTTGCTGCTCGGGCAGCTCCACGAACGGCTCAACTGCCTGAAGCAGGACAGCTTCATCATCGGCTAGCACGCAGATGTCCTC
GACACGCTCGTTTTCCAGTTGCTCACCGGGCTGCAAGAAGAAGCTCGCCTCTCCCTTCCGCATCTCGCGCGTGCCACGACGCGGGACTCCATTCACGATG
GGGTCCACCACGACGCAGTACTGGCGGTTCGTGAGGATCGTGACAGTGACGTATCCAACGATATCTTCATGTACATCTTGGACGTGTGTCTCGGTCGTCT
CGGTCGTGATCAGCCACTCTTCACCAGCGCGACGCGAGATGCCGTACACATCCTTGAACGTACGCAGCGCGCTCAAATGGAGAGCAGCGTCCTGGGTCAA
AATGTGGGCTTGAAGCGTTTCGACGAGCACCTCGTCGATCTGCGGCAGGTACGCGCCTGGAGTGCGCACGAGCCACTCCTCGCCAGCATCTCGTTCAATG
CCCTGCGAGTCCGTGCACTTCTTCTCTGCGCGAAATTTGATGGCCTCGTCCTTCTTGATCACGGACGCGTGCACGACGGCAACGATCTCCTCCTCGACGC
GGGGGTAGTACACCGCCGGCCCCACGAAGAGCCACTCGTTGCCTGCAGCATACTGGCCGATTTGGCGCAAAGCGCGGATGCGAAGCGCCGTATCCACGGG
TACAACTCGAAGCTCGCGGATTTCTCCGACCTGCTTCTCGCCTGGGTACAACGGGAAAGGCTCTGGGTACTTGTCAAAGATGCGGAACTCGATCTCGCCG
TGCTTGAGCTTGGCCTGATCGAAGGCGTCATACTCGATCTTGCCGTCCTCGGAGCGCACCACGGGGTTGCGCACCTCAACGTAGTGCTGCGCCGGTAGCA
CGATCATGTCTTGCGGAGGCGTCAGGATGAATTCGTGGTCCTGACGTGTGAAGGTCAGCGGCCCGCAAGAACGCGGGAAACATTCGAGTTGTGTCCTGGA
CATGGACGTATTTGTATGGTGGGCAGGCGAATCACGCGAGGGCCGCCGTCGTTGCTGTTGCTGGCCATGCTGGGCATTAAGGGGCTTGGTGGATGACTGG
AGCTGGTGCTTGCGCTTGAAAATGCAGAAGTGAAAATGAGGTCTCTGATGGAATCTGCGATGGTTTCAACCTGGGTTGAAGTGACATGGGTACATATCAC
CAGCTGTGCAGGACGTCACAGTCCGTTGGGATACTCGATGCGGCATCTGTTGCTGCAGGTGCACCACGGTTGTCTCTGCGCTAGGGGGTAGCGCTCCGGT
TCGAGTCTTCCAGTGTCCTGCCCCAACCTTAATCCACTCGCTGCCGTTGCTGGCGTCTCCGTCAACCAGAGGGGTAGGAACTCGCGTCCCTACCGACGCT
TCAGCCGATGGCCTTCTTGTCCCGGCTGCTAGGATTTTCTGCTGAGTCTTCAGTCTGCGAGACCTCTTTGTTGGTCTTTTAGTCTGAAGTGTTGGCTCAG
CGACGTTTGTTTGAGTTGCTGTGACCTCTTTCTCGACTTCTCGGTTTTCGCGCTCCGTGACTGCAGCATGAGCAAACCGAATGCAGCTTAGTGTCTGTTG
AAAATAAAATCAACAAATACACACTGACCTAGCTTTCTCTCCAGCTCTTTCAAAATGATGCATGCTGCTCGGAGGTGCCGCGTCTCGCAATGCTAGTACT
GACCCCGCCGTAAAGCAGTCAATCATCGCTCTCTTCCTCTTCCATGATCGAAAAAAAAAATCACCAGGTATTTGTCATCTCGATCGCTATAAATGGTTGA
GTCGTAGTAAAAGCCTGCTTGGTATTTGGAAAATAAACAGAGCGAGTTTCAACACGAGCTAGTAGGGCATGGCGCCACGATTCTGCTGCAATCATGCTTC
CTCGCCATCCTGGAGAAAACAACGCATCGAAGTGGTTAGTACATTCATACTAGCATAGCAGCAGGTGAACCTGTCAACCATAAACGTACCTCGACGTCGT
CGTCACGGATTCTAATCCGCTCGCGCTTGATTGGTGGTTCGTTTCCGTTTTGGATACGCTTGAGTGAGTCGCTTCGCTCCCGCTTAATACCAGACGCCTC
GCGATCAGCATCCTTGTCACCCTTGTGCTCTTCTTTAGCATTTTCATCCCTGGGGGACGAGGTTGTTGCTTGTTGGGGGTTGCGACTGAAGCTTCAGGGG
TTTCTTTTCTCACATCAGTGGTGTCCATGCCCAGGATACCCTTCACTAGCGTGCCTGTACCCTTGACCGCCAAGTCCAGATTTTTTACGCTCCCCTTCAT
TGCTGCGCGCATTGTTCGCCAGCAGACCATCTCATCCTTGTCAGGCCAGTACTCTTCCTCAATGCCATTTTCAGGGTCCCACGCCTCCTTGAAGCGGTCC
GTGTATGCTGTCAAAGAAACCTCCGTGGCTACCGCACCAACAAAAACACAATTAATTAAGATATCTTGGTGAAAAGAGCATGAACGAACTCAAGGTCGTT
CCAACACTCACCTCTTTCTTTGCCCTTAATCTTCTCCAAGATTTGCGATGGCTTCGAGCTTTCCAACAGAATTTGCTCCAGCAGAGGCGAGGTTAGCTGT
CGACGAGCTCGCTTCACGACGTGCTTAGGAGCAGACGAACCCCCCTTCTCCGCTGCAGCTGGATACTTCTCGTATTCCGGGCACTTCTCCTGCTTCCACT
TGACCCAGTTACGCTCGCGCTCGAGAACGTACGAAACCATTTCATTGAAACCCTCGCCATCAGATGGCGTTTGCTTCAGCAGCGCGACTACACGCTCAGT
TAGTTCGGCAAGCATTGCTTTCGGCGTCGTGCTGCCCATAGGTGGCTTTGCTCTTGCCAAGTCGTTGAACAGAATGAGAAACTGTGTCAGCATGCATTCC
CGGAGGATCGGGTCACGAAGCTGCAGTCTGAAAAGACGGCTGTTCGTCAGGTACTTCGGCTGGAAGAAGTGTTCCTGTGAGCCTTGCTCACTAGCATCCT
TGCTAGTATCACTTTCCGGCTCGTGTATCGTAATATCCGCCGAGTGAATGGCACCTCCACTGCTACCCAATAAGTCCCGCGACCGTTCCAGGTCATCCGG
CGAAAACGCATTTCCTTCAAAAGCGGCCAGGACCACATTCAGCTCAGTGAACTGAGTGCATCACACATCAACAGGAGGAATACGTTAGTCAAAGCATCAA
AGTTCACAAGGAAGCATGAAACGTACAAACTTTTCCCAGTTCTCCGCCGACTGGGTGGCCATCTGATGCTCACGGAAGAAGCTTTGCAAATCCCAAAAGG
TGCGATAGAGGTTGTAGTCGATGGGGCCCACGTCGGCGCTAGGATCGCTATCAATCTGCACAATTCAGCACCACCATAAGTACGTGCAGATCTAAATCCA
CCCAAAGGGAAAATATATCGCAATTCCCACCTCCAGCCCAGGAACAACTTCCGAAGCCTTAGCAACGTCTGTAGCCTCAGCCAAGTCGAACGCATCTTGT
TCTTCGAACACCGTCACATTGGTCACATTTGACTTGCCCGTCAGATTCACAGCCGAGCGCTCAGACAGCGCGAAAGTGAACGACAAGACACCAAGATCTT
GCCGCAGAACACGCTATTGTGCGTTTTCGACAGGCGACGCAGCAGGGCGTTGCACATCCGCAGCAGACACAGCGACGCCTTGGTCGTGCGGCCCTTCTCC
GCGATGAACTCCGGCTGCTCGAGCAACAATTCACGCGTCAGTTCCTCTTGAGCTCCAGCAACTACGACTCTAAGCAACCCACCGTCGTGAGCTTATCCTT
TCGGGACTCCAGCAGGTCCCACACTTTCTCGCACGTGCTGATGGTCTGGCCCTCCATCAGATCCTCCAGCACCTTGTAGGGCGTGCTGTTGATCAGGAAC
TTTCTGGTCACGCCGGAGATGCACAAGTCCAACAGCGCCGGGACGCCCACGCTGCTGGGCGTGGCGTGAGACTCCGTCATGAGCTTCCACGAGAGCTTCT
CCACCACCTTTTGCACCGCCAGATCCAGCACATTGTGTGTGAACTCCTGTGGCCGCGGGGTCTTGAGCTCCTCCACGACACCCAGCGTGCGGCTGTACAG
CCGGTC