Description :
From Genome Similarity Track
Location :
Scaffold_39:44964- 46310
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012064Similar to RWDD1: RWD domain-containing protein 1 (Homo sapiens)
Pytul_DAOMBR144PYU1_G012063Similar to RABGAP1L: RAB GTPase-activating protein 1-like (Gallus gallus)

Sequence
1346 bases(100 bases per row)
AGAATATTTAGTCGAGAACAACCACAAGGGCAACGTACGTTCGACATCGATGACGATTCTATGGAGCGCAGTGCGAGGATGACAGTGGACTGAGTGTGTT
TCGCCTTTGTGATATGTGCACAGGACGGCTCCGAGTACCAGGACATGCTGCGTCGCCTAGAGATCAAGAAGAAGAAGGACGACAAGGACGAAGCGGACAA
GTTAGAGCAGGCAGAAGCCGACGATTCGGAGAAGAAGTCCCGCGAATTTGTTGGTGCGTTGAGAAGCGAATTTTTGTTCCCCGTGTAAGTTCTCCTTTAG
CAATGTTGTCGCTCACTGCGTTTGCATGTGTGCTTCTGCAGGCACGGCGGTGACGGTCGAGTCGTTTGCGATCTGGCTGGCGAAGTTTGAAGCCGAGATG
CGCGGCACGCAAAAAGTATCTTTGAAAGACGAGAGCACTGCCAAACTCACGGGTGCGTTGCACAATGTCCGGGTACAACAGAATTGTTTTCTGGAACTAA
ATGAACCTCTGTTTGTATGATGTCCTTGCAGGAAAACAATTGTGGGCCAAGGGTCTCGCAGGCGACGACGACGGCGATACGTCAACGATTCGCGGCGAGG
ATGGAGAGAACGACGACGAGGACGATGACGACGACGAGGACTACGAAGACGGCGATGAAGAGGACGACGACGAAGACGACAACTAAGGCGTCCATTTTCA
AGTTCAAAGTGGTAGGCTATTGTGACAAACGGTGTTCAAATTCAAAGGCGGCGCCTGCCATGTAGCCTACTTCTGGGTTTGGTTCGTAGGTTATGTTATT
CCCTATCAACTCTCGAAACAACATGACACGCATGGGTATGCGTACCGCAATTGTGGTACACTTCTGGTTCTCTTTTTCTTTTTCGTCGGCCTTTTTTTAT
GGAATGCTTTCCTTTCTGCCCATAAAGCTCCACGAGAATCATGGCATTGGGAGGAGCTGGCGTGGCGCTGCCGCCATCCTTTGCCGCTCAGTCAGCGCCA
GCACCGCAACCGCTACAAGTTGTGACGACGATGGCGCAGTCGGCTGCCTCTGCGGAGCGCCTCAATGCGCTCGCGATCGCGGCCTTCTGCCAGTACTGCG
AGGTGGCGTTCCACCAATTCCGACCGCGCTACACATGCAACGTGCGTGCTTTTTGGCTTGTTTATTAGAAAGAGCCTGCGTGCGCGTGCTGCTAACGGCA
GTGAGTGGGAGTGTCTACGCTTGTAGGTGTGTTTTGTGCAAGTGTGCCAGTTCTGCGCCTGGCATAGCGGCGCAACGCGCGCGACTTGTCTGCTCTGCCA
GGTGCGTGATGCTCGATAGTGCATACCGCGTCCCTATCGCCCTTTC