Description :
From Genome Similarity Track
Location :
Scaffold_248:4496- 8361
Sequence
3865 bases(100 bases per row)
AGGCGTTCCAGACGCAAAAGTTAGAGCGATATTCGGCGTTGGTGGATTCAAGATAGCGCGTCTTAAAGACGTAACCAAGAATGGAATCGACACTCTGCAC
ACCCGGCGGCAGCGTAGCGGCCCAACTCACTCTTACTCAGATGATGACATGAAATTTCTAATTACAGACTGTAACGAATGGGAACTTGAAGAAGGATATC
CATGTTCGCATCGTAATTTACGGAAGTACTTAGTGGAGCCTGGTGTAACTTGGAAATTATTATGGTCAAGATACAAAACAAAAGCGGAAGACCAAAGCCG
TCGTATTATGGGGTATTCGCGATGGCTCCAGTACGTACACTATTACTTTCCTGGTGTTCGTTTATCGCGTTCAAAAGAGGATTTGTGCGACGCTTGCACG
AGAATTGAGACGCTGCTACTGAATCCAGACATTCCTGATTCTGAACGTACTGAGCTAGTTGCACAAAAGGAACTTCACTTTGATGCAGCTATAAATCAAC
GTCGGACTATGTCGGCCTTTGTGAAGCAATTTGTAGCTCAGAAGGCTCCAGAGCAGACAGTTCCTGAAGGAATTATCCCAGATCACGTTGAAATGCCACT
AAATATGGAGCCCGTGGTCCATGTAGCCAGACCGACACTGCAAACACAAATTGAGGATTTTGGGGGAAATATTCCTCTTCCGGCTTATAACAGCAAAAAA
CCATCAGCGGACTATTTTAACTCGAACCTGATGATGCACAATTTTGTTATTGCTGACCTCACGGATGGTATCAATAACATTCTACTTACGACGAGCGTGG
CAAGGCAAAGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAGAGGTTGCCATCAGACGCTGCACGCACTAGCCGTCTGGTT
TATCTGTCTGTCAGAGCTGGTAACGTCCCTGAGCGCTCAGGGTCTTCTGTGACGGCGGGTTGGTGATACGTCGGATGGTGTCTCTTCTGCGACTGGTAAA
CCGGGCGATGTCTTGCCTGCTAAAGCCGGCTTCAGGCCTTCAATCCTTCCCCGCTCGCGCTCGGTTAGACGGGGCTTCTTTGTTTTTGCTACGGCATCCT
TCTGCGCAGATTGGGCCTTCTGCTTCGGTGGCATATTGCGAGATGAAGCCGGCAGACTTGCCATAACAGCGCGCAGTTCTTACTGCTCTGTCCACTCACG
GATGTGTAATATTTTAAAATCAATTACACTTGACTTTTTGTAAAGTACTAGGTGGCCGAAATAGCCTGACGCAGTGCTAATATCGAAGGCTGTATGGCAG
CCGCCAGTAGGCTTGGGAATGTCGCCCGTTCGCACATGCACCACGTGGCTCCGCGTTAGCTTTAATACAAATCTAAACAGCGTGCCCAAACTCGTAAAAT
TAACTGAGTGACAGCCATAAATATGGGTGGTCGGTTTAACCGGGCGCGGAGTGTATTGTTTAACAGACATGTTGGTCGGGTTAAGGATGCGCAAACGACT
TCCGTATCAATGTTTACTCTCCGTTGAACAGGCAATCCAAAAAATTTCAAAGAAGGGGTGTAATAGGTGCGTCTAAAACAGAATCAAATAGCGCCTTTCT
CCGTATAGTCGGTGCTTTGGATGACGTGACGAGCTGAGAGAAGATAGCCACCAGCCGAAACAAAGAAGGCCGTTTCATACCTAGAGTGGCTCAGTGACTC
GATCCATAGGAGTACTCGAGAGTCGGCTATTCTTGCTTGGCGTACTCGATCGTCAGTGGTTATTAGGCGAAATCCAGCAGCACCCAAAAGGAGTCTGAGC
AAGTCGTTGTTTGTCTGAAGCTGCTGCAGGATGCGCCGTTCAGTTCTTCCGAAGACCATGCTCGATGTGCGTTGAGAATTCAAGAATGATAGGTCACTCG
AGGAGGAGGATAGATCAACCGCGCATTTTTTCGATCACGCAGAAAAAGGCACAATCCAGGGGCGGGGTGTGAGTGTGGTCTAACTGAAAGATGATCTTAG
CTTCGGCTATCGACGGAAGGTCAACAAATATCAATATCTGTTTAGTTAGCTGTGTAGTTCTGACG