Description :
From Genome Similarity Track
Location :
Scaffold_72:44959- 50228
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_72-fgenesh-gene-0.8Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_72-snap-gene-0.60Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_72-fgenesh-gene-0.9U6 snRNA-associated Sm
Pytap_DAOMBR444maker-pag1_scaffold_72-snap-gene-0.61Skp1
Pytap_DAOMBR444maker-pag1_scaffold_72-snap-gene-0.62Transmembrane protein

Sequence
5269 bases(100 bases per row)
TGTTAAGTTCGCAGTGTGCCCTTGTTCATTCATCGTGGCGCACAGACATCAAAGCACACTGCCGCCACCATGAAGATCTACAAGATGCTGGTGCATTACG
GCCTCATGTTTACGGTGCCGACGGCCgCTGCGTTTTACTtCTGGAAGCCCAAGACAGACGAAGAGATCCGCGAGGAAGTGGTGCGTTGGTTGGATGCGTC
GTGGGCGTCGGTGCCAATGTATTTCACTGACACTGTgTGCAGGAGGCGCGAGTGAAACCTGACTTGGAGCGACGACGCAAGAACCAAGTCAAGTATCGAG
AGCTCCTGCTACAGCGCGAGACGACACAGGAGTCGCAGAAGCAGCTAGAAGAAGTCACGAGCTTCACGCCACGCAAATGAGGAGAGAGTTGTGACACGGC
GATAATTTAAACATGCACACGAGCCATGATAGCGTGGTTTCCGTATTGATTCACTGtAAGTAGCGCTGCATTCGACTGGCATGGACAGAGTCGACTTCTT
GGAGTGCCGTCTCTAGCTGCGTTTGGAGCTTCTTTAGGACCAAGTAGTCTACGCGGAAGCACTCTGTCTGGACTTGTGGGATGCCGGTGTCACCGACTGA
TGCCGTGTTAAGCGCAAGTGTGACAACTGGAGTGGGCTCGTTACGAGTCATTCGGTTAGCGATCTGCGCGTTCTTGAGGTGAGATGACAGCGTTGATATG
CATAAAAAAaCCACACCAACCTCAAGGTCAACGCGCCAGTCGAGCGAGCGATACTGCGGAACATTCATATCACCTTGCAACGTCgAaTTCTCTCGGATCA
ACTCACGATGCTCGACGCATAGCTGCATGTAGCAACGTCAACCGCATACACATGACACCGTGCCGAAGATAGCAGCTCACCTTCGCGAGGGTATCGGCGT
GTGCTTTTGGCATTGCCATCCCTCTAAGCGACGCTAATAGCAGTGCATCAGACAGATCTGCCTGTAGTGcGCAACGGATGAAATGCAGTTtATGCGCGCC
GGTCATCGCCATTCCGTAATGTTACCTTAGCGGCATCCATGATGATTTTCGCCACGGCCAGCACGACGCCTTCAGTCTGCTCATTTGTCCACCCACACGC
CGCTATGCAGAAACAGACGTGAGCTCCAGCAGTACACCACATAGCACGCGTGACTCTCACAGGCAGTGCGTGTGAGCCGGCGGCGACTTTGCTTCTCGCT
GTGGAACACCAGCACGGCCAGTTTGCACACGTTTTCGAACTCTGCAGGCAATCAACCCTCTATCAGCGTGGGCTATGAACATGCGTCCGCACCATTTCTT
CTTAcgTTCCAGTGGCGTGTCCTTGACGCTAGCTACAGCGTCAAGCACTCGCTCATCCCATGCGATCGTCCGCATTCTCGTTAGCTCGATCCTTTGCCCA
ACTTGACTCGgAaGCTTCCAAGGAACTCTCAAAGTTGATATCTCACTCATCAGAGTGACATTGGGTCCGTAATTGATATCATATTTGGGGATAGTGACaC
CATAACCGACCTGAACAAAGGACTGTGGTTACACTGGAGCCTGCCTGGAGCGCTGCCATCAGGCCCAAGAGCATCGAGAACCGGAGCGACGATGGCGACG
AACGGAATGACGGCGCAGGCGCCACGCCGCGACAACCACATCCTGGACCTCGCCAAATATGTGGACCAGGCTGTGCGTGTCAAGTTCTTCGGTGGGCGCG
AGGTCCACGGCGTCCTGAAGGGCTACGACCAGCTCGTCAACCTCGTGCTGGATGACTGCGTTGAGTTCATCCGTGACCCGAGCGACGAGTACCGCGTGAC
GGATGCGACGCGCAAGATCGGTCTCGTCGTGTGCAGAGGCACATCTGTGACGCTTGTGTCCCcAGTCGAAGGCACGGAGGAGATCTCGAACCCGTTCCTG
CAGCAAGACGAGTAGATTtAGCGGAGAGGATGGAGAACGAGAAGTTGAAACATCATATACGTGTATATGAacGCaCgtATGTCACAAgAGgTGTTGATAT
CAGTACTgCTTCGAAGTGCATTGTATctACGTGAGAGACGTGTACATCTTAGCTACCTGGCGGGCTTGGGGCCAGCGGAGCAGAAAGaGGGAGAAGAGGA
GCGATACCGCGAGAGCCAATCGCGTGAGCGCAACATGAAGGAAGATCATGAGAAAGCGCTGTACAGAGCTCATCgCCAAgAagAAGCAACAAGTCCATCC
ACCACTGCCATGAAGGCAAGTGAGACTTCCGCATTTTCGAtGAGGACCTGCAGATCATGtGCGAAATGGTTGATCGACgTGTATCCAGCTTGTCTGCGAG
CCATGTTCAAGGaCAAGCTCTTCCGCTTCCAGAGCTTGGTCGTTCAGACCAGGAGAAGGCAAAGCGCAAGGCAGGCTCAACAATCGCTATCATTTCCTAT
CGACTACTACGCAGTAGGTTTTATGATAGTGgTGGgCATCCACATACCAACGGGCCACTTCCCGTCAtGAGAACATCACAGAGGTCGAATGCGAAGGTGA
ACgaGTGGCAtAGTTTGCATGTACTAGAGCTGGCGTGTATCACTCGAAgTGCCTCTGCCAGCTGATGTTCAGGAGGCTGAGTTTCATTGGaCACGAGAAG
ACGCATGTCAACCGGGAGAGCGATCATGAAGGGCAGCTAACTTATATTTTTCTCTTATTGTCTTCTtGTTGAAGATTTGCGAACGCTACATGGGGGTGAG
GCTGTCAGGACAATGAATCGCTTAGATGTCTTCGCACCACTTGTTCTCCTCACGGATCATCTGCTCTTCTTCTGGAGTAAACTCGGCCGTGATGCCAAAt
GTAGCACGAATTTCTTCAGGAGTCTTGCCCTTGATCATCGTTGCGACCTGCGCGCACGTAAGGTCGAGCAGCGACTTAATGTCCATGTAGTTGGCGGCCA
GAATCAGCTCAAACAGCATCTCCTGCTCGAGCTTCGTCACGAAGTCGGCGTCCCACTCCGACACGGCATCGCGAATGTCATTCGTGCGCAGTGGCTTCTC
AATGTCCTTCATCGGGTTGTTGTGGTGGTGCTGGCAAAACTCGATCACCTTAGCGAGCACcGAGGCCTTCACGTTCGGCAGGGGCACATCTGGCGTCTCC
TCGTCGTCCTGCTCTTCGGCCGTGAGCGTCTTCACGAGCTGGCTCACGGCGGCGACTTCGGCGAGCACCTCAAACTTCTCTCCGTCCTGCGACACGAGGT
TGACCTTGCTCATACTGGCGGCGTTgAAGGGGGAGAGGCGCTGGAGCTGGATGGAATCCGGGAaAAgCGGTTGTGTCGGCGCCAACGGACTGCGGCGgCG
TGGGGCTTTTTCCAACAAAAACGCGGGTGGAGACCATCATTCAGCAACGGCACGACATCCGATCGTCTGTGAGAGGGATATctATTTCCAAGGTGGAAAT
ACAACGGAAGACTACAGGAGGTGAAATGATGTCATTGCCTGATGCATGTAGTTTGAGAGGTCGTTcACCCCTGGCTTCTTCTCTCCCAATTCGGGACACA
GTCCCTTGTGGGgAtGTATCTCGCAGGTCATCTCTCGCACCTGAGTCATgaGCTGTCAGGTGGCATGTCCCCGTTGGGTGCATGATGAGGATGATGGCGC
GACATCATGGCACGCGAAGCGGCGCTGTGACGGCCAGAGGATAGCGtCCCCGGACGCGTTCGCTCCAGTATGAGCACGACACGCGTGCGTCGGTGGGCAT
GTAGTCTGGCTCAGTGCCATGCgCGGCGCAGAACGGTGTCTCCTTGATGAAGATGCGTGACGTGGCGGCCACGAGCCACGCGGGGACGTCGCTGATCTGC
GTGGCGATAAGGTTGAGGCTAGCGGCTCCACGAGCCTCTGCAAGGCTTCTCGGTAGCGTCGCAATGGGGTTGAGCGCTAGAGAAaGCTTCTGGTACGCGC
CACGGCCGAGGGCAAAGGCGTCGGGAAGGCTCGAGATGCCATTGTTCACAAGGGAGAAGTCGATGAGGCTCATGCGTAGCAGCGTCTCGGGCACGACAGT
CAGTTGCGAGTGTTCAATGTAGAGCGATCCGACATGGCTCCACACGCTGTCGAGGTTGTCAGGCACGGACGTCAAGTTGGTGACGACGAACTCGATGTCG
GCGAGTGGTGTCGGGAGATCCGGGCCGAgAATTCCCGGAGGAATCAcACTCAAGTTGGTGCGAACGAAGAAGACGtaCGTGAGGAACGGTGTCGTgaGGG
cGgAGATGGCGGCGTCAGcGCCCCAGTGGGAGATCGTCGAGTTGAAGATGTCGATGCCCACGAGGTTGCGGAACTGGTGGATGGCAGGAGGCACGTGAAG
TGCTGGACAGTGAGTCAGTAGCAGGATCGACATGGatGGAGCATGGAGTGACTCGAGCACGTCAGGATCGACTGTCAGAGTGTGCTGACGGTAGCAGTTG
TACTCAAAGACGGCGCAGGCGGCCTCCcGTACGAACCACGGACGGAGGGGCTGTCGACAACCTTCATGAAGGGGCGGATGGGTCATGCTGGAGACGACAT
GGCAGCTGGCTACGGCGAGACCCCACAGCATGAAGCAGCGATCGATGATTCTCGCCCGCTGcACCTCTCGTTTGAGATCACTGGTTGTCGGAAGACGACT
ATGAACGATGGCCGAGAGTACGCGTGTGGCCCGACGCGAGTGGTGTGACTGCTGAGACTGACGGGACGAAGCACTATCCaTGTGTTTCTTCTTGTTGCTC
TTGAGTGTGACGATGGATTCGATCGTCTTGAGGGAGAGGTAGATGCTCACATgaGGggATGAACTTGATGAAGAGATCGGTGTACGAGAGAGGGAATATC
TGTCGGTTCTCATTGATCATGACGATGAACCACACGTCGTCATAGAGCAGCCGTGTCTCGAAAGTGAAGAGTGTGAAATCGAAGGCTTGAATGTACGGAA
GGATGAGCAGTTGTGGCAGCATCATGGCAGTGCCCGCATCCAGCATGGCATCGACTGCGGTGCACACCAAGCGTTtGGTTGAGGCAGTGGAAGAATtgAG
GACACGCTGGACGATCGGCGTAGACCAACAGTTCAGCACagCGAACGCCACATACAGGTCAATGAGCCATCGGGTTGGATCCAATAGGGCGCTGGACGAA
TACGCCTGAAGCgTCTGGGAGATGACCTCGACACTTTCGGAAACGGCGTACCGgTACTCATAGTAGCGAAACTCGACGCCGAACAAGCCGTGGCGGCCAA
AaATTGAGCGCCATGCGCGTCTGAAGCACGCCGCGATTGGAATTCTGGGAGGAGAAGCTCCTTCGGGGC