Description :
From Genome Similarity Track
Location :
Scaffold_18:449554- 453381
Transcript NameFunction/comments
Phyca_LT1534527340serine hydrolase (FSH1)-like protein, putative
Phyca_LT153416186elicitin, putative
Phyca_LT153438288PREDICTED: uncharacterized protein LOC581799

Sequence
3827 bases(100 bases per row)
ccgcctccattcgagtcctccaagaagattcgcgtgttgtgtttacatgggtttcgcaccaacaaggaggttatgcaggatcagactcgtggacttcgag
cggtgctgggggattctgctgaattcatgatactgaacggcacgtacgaagctcgcgggtcgagcgatcccatgattgatagtgcatacaagtccagcgc
cccgttctacgagtggttcgagaatcaactggctgacggatctccgctccagtacaacgacgccgaatcgtccgccaaggcacgtcttctaagtggcgcg
gacaaaggagaagaccacgcgtggagtttatcctacaagggtatcgagcagtcgatggtccgaatcgacgaggagcttcgtcgtcatggcccgttcgacg
ttgtcattgggttttctcagggtgcagcgctactgacgattctgacgatgtggtacctgcgccacgggaatgtccgttggtggaagctggtgatctgcgt
tggcggtgtggatgtgagtggtgtcaatgtcaagtcgctgtttctggataaagcgggcaatcgcattctcgtgcctctgccttcgatccacctcattggc
aagacggacccgctctaccatgagtcacatcgcttggcattgtcgtggacagataaagcagagctgaacgatttcaagaaacggatctacgttcatgacg
gtgggcacaaattcccttccgtttcgatgaaccgtgagttctacgcggagctgggccaagtgatcaaacagcactgcaacaaagatttggaaacatcgac
agctagactgtaagtgctatttagcttcaatgaagaaatttgcacaaatacttgcatagttcgcaatgccaaaacagcaaaagttcatgctttgcgatca
aatgagtttacagtaactagacaacagggcaagttgttctatcgaagtggcgcccgagtcttaagcactttagcgagcagaactagtgaatttcacgtca
aaacggaacttcgtttattgagttcattactacgagctgattgtcaacgtcactatcgctgctcgtagtcgttgtgtagcgatctaaatcgcttaagccg
acagaccgagagccgtgcagttcggcaggaagctctccgccagttgcagcacgttgatcgacacggtaccaaagtcgatcacgcagtccgctggcttcag
gtccagaaggttaccaatgagcgagtagcagtcggaggtcaagcacatgagcaggacctcggtctccgttgggtaggccgtcggcggcacaaacgtgtag
cccgaagcggtctgacacgaatcgaggtacgggtcagcggcaagtgccagcagcttcgcggtctccgaggaggggcaaatggtcgtctcgtcataagcag
cagactgcgtggcaaggcaggcgacagcggcagcagcggcgtaggcgaaggtcttcatggtgttggaagaggagagagggggaagctggtgttggagctt
ggaagaaaattggataatgagctcaaacagagactcgagaacgacttcggtgcgggcgtagagctctcgtcgaacggcgactgtgaccgacgttgtccag
caagttactgtgtcctcagccagcgggaagatggaagccacagcgtcaacagcaattggttatgaaagcagacttgcctttcatcatgcaagttgcacgt
ggcactttttgctgtgctcacttcaacaaggatagtgttcttagagacttgcttcggtgtcttccttctggtccgcccaaagcgatctattgccagtcaa
tttgactgttccggtgactgccgtggcacgatgtaaagctcggggtgagcttgctgaccatgcaaaagcggacaacttcaatgagttttacctgatccga
gctcaccttatgctgagaccgtacaagttgtagaactacaacaggcgccttgaacggaaagtctcaaggaaaccgacaagagttcgttctagctgagacc
aaatagcgtgtcattggacatatcgtttgtgccctgtgcttcctgaagcgactagagatcaagaacaatacattttattatgcctcgttctattgtttgc
aagaagtaccaataactcctgcacattcgatattttatccggcactatctctgagtcagactagtttttccttaagtgaacgaccccatgaccaggatgt
gtgcctgtaagaaaggctcttgttttccttcacgtcgatgtcgcgcatgctggtgtttcactgtcgtgcgggaaaagctgttcgtgagctggaagtgcta
ctaggctgataggcgacactagcaatgctagtctagcattcgcgtacgcacattaaattagcttaagttcgttgatatcgaagttgcaattttgcaacat
accggtacaagtagtagtaagatctcaagttgaagttgcagtatgtgttacttatgtaggtcattacttcgtcctaattccggtctcaattgcgatcgtc
ctacgttatgcttgcccacctccagctgatcgttctgctttatctggtcctgccacgcttgtcttcatcaaataccacagaggaaagtcaagctcaatgg
ctgcaagcgccgtctggcgcctccacgtcgatgtcggcttgcgcgttcactcacatgcaccctcgtcgatacggagcctaccaccttcctcctcaaccag
atccgttctcgcccagtatcaccatcgatggcgttctggacgagaaagtgtgggccgaagtgccatggagtgagtctttccaagacattcgcggcccgac
gttctggtctcagccgtggttcaccacaaagttcaaattgcgctatgaccagaagtttctctacatcggcgcttatatcgaggaaaccgaggtgtgggcc
aatgtgtcacaacgaaacgaggttattttccatgacaatgacttcgaggtgttcgtagatgctgacgggaccactcacaactacaaagagttcgagctga
acgcccgcaacgccacttggaacctgtggctgaatcgaccgtacaggaatggcggacacgagaacagcactcgagtggacccgcatttcggatttgatat
gttgaatggtggcatgcagtcggcggtttttgtccgggggccaattaatgacccaggtatgttgaaatacctgtgaattaaactatgattttacagctaa
ctggtcatttttgataccgctttgcagccgaacgtctacactattggactacagaaattgcactaccgttgtctaagcttgcgttacactcgacggcaca
agtcccaccgaagcctaattcattttggaggatcaatttctcacgtgtggaatggccagttcgtgttataacggatggatctactggcaaacaacactac
gagaagaaaactgatttaaaagaggagaattgggtctggagtgcacaatacaaggtggatatgcatcaacctgagtggtgggggtatttgcagtttcgac
cacaaggggaaacccctccagaattgatcgatacggatgaagtggtgccttttgatcctgcttggggggttcgatatgtgagttttcagttttactacgc
ccagcatgcattccacagtgcaatggggaaatacaccgcaagtttggagcaattggtcccttatttcaccaatcgtgaagccgttcagtgtaccaagctc
cttgaagtgactgccaccgacaaagcgttcagtgcgcagattggactccgtgcagttccttttgatgatggctctgagtttatagcaagcatcaaggagg
atggctacatttcagtggagaaggcgc