Description :
From Genome Similarity Track
Location :
Scaffold_329:4495- 11066
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_329-snap-gene-0.14MGC89050 protein isoform 1
Pytul_var.sporangiiferummaker-pug3_contig_329-fgenesh-gene-0.8Ubiquitin carrier protein
Pytul_var.sporangiiferummaker-pug3_contig_329-snap-gene-0.15Vertebrate cysteine-rich hydrophobic domain 1 (CHIC1)
Pytul_var.sporangiiferummaker-pug3_contig_329-snap-gene-0.21Transcription initiation factor IIB

Sequence
6571 bases(100 bases per row)
CGTGCACTGCTTGTTGTGCCTTTGATGCAGATGCTGCCGCATAAATCAACGCCTGAAGAGCTACGCAACACGATAATAAGCTAACGCGGTCAGCAATAAA
ACAATGCATGTTGGAGCTATTCATGCATGAATGGAGTATAACGTATCGTACCACTTCGAAAGTGCTTTTGCGCCTGGCGCAAATCGTTCGGCGGTAACGA
ACTGAACCACATGATCGTGGAATTCTGGAGCTCAAGCTGCTGCTGCTGCAACCGTGACGCTTCTTGCTCGTCATCCTCTCCTGTCTGCTCACTGACTTTC
GCTTTCCCCTTGCGCTGCGTCAATGATGATGCGTTCCTTACTGCTGTTGTCTCAGTTGCGTCACTTGCTGGAGACATCAGCATCCACTGCACAGCATCAA
TCCCATTATCGTCACCCTCATCCTGCTCGTCTGAGTCATTCGTGTGCTCTGATGTCTGTGCTGCGACCACCGTCACAGCATCAAAATACTCGTGGTACGA
CAAGTCGCTCAGCGCATGCGCCGGCAGGTTGCGCCGCGCCATCGTGAGCTTCAGGAAGCCCTGCAGACATTCGCATGAAGAGAAAACGGCACATACACAC
ACAAGTCATGAGTGCGCTCTGTTTGCCCCTGCGCATTTACAGACCACAGCACCTGTTTGAGCTTGTCACACGCGCGCTGGTGCTCGTTCAGATAGTCCTC
GTAGGCGCAGAGTCCGTCGACGAGCAGCGAGTCCTCGAGAAACTCGCGCGGCACGCTCGCCTTCTTCATTTTTGATCCTTTCTGCAAATGTGGACACTTC
CAAAAGAGACGCCCTTCCATTTAGAAACACGTTTCTATTTGTAACCATCTTGTGTGCTTTCAACTATTGTAAGTTCTTTAGCAATGCGTGTTTTACGTTT
CTAAATGCGCCATTTGGCTGAAGTAGCAGGCATTTTCCTTTTCTTCTTTTGATACAAAGCATAGCAGCAAACGATGAAGAAGGTGGCGGCGAAGAAGCAG
ATCTCGCAGGAAACGTTCGACGAGTGCGTGCGTGAGAATATGGAGGAGTTCGACATGGACCTGGAGGAGGCCACGCAAGATGCGGTCCAGCAGTTCGAGT
CCCAGCAGGTCGACCTCTCCAACATTATCAAGCACGTGCGCGCTGCGAATGGCGACGCTGGTGGCGACGCGCAGCCCGAGAACATTCTAGACCAGATCAA
GCGCATCATCAAGGAGCTAGAAGCCACGACCGAGAAGATGAAAGGCGCTGCTTACGATAATGAAGACGAACAGCGCATTGTGACCAATTTGACGCAATTG
CAAGTGCTGTGTGACGAAGTTCCGGAAGCGGCCGTCGTCGCNNNNNNNNNNNNNNGGCCGCAACAATGCCATTGACACATTGCTGGACCTCATCGACGAC
TCAGCGTNNNNNNNNNNGAGCACGAGTGTATTGGAGACTGCGAGCGCTGTCCTGGTGACGTTGTGCACAAACAACTCGGACAACCAAGACTTTGTTGGTC
AGAGCGGCATGGCGCGTCTCGCGGCTGTGCTGAATGCACCAAGCACCACAGAGAGCAACGTGTCGACAGTGGCGCGCGTGCTCACACTCGTGAAGGCTGC
GTGCGCCAAGCACGAAGCCAACAAGACGCATTTCACGAACGCACAGGGCGTCGATGCCTTGTTTGCGCATTTCGAGAAAGCCACACAAGACGAGGGTCTC
TCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATTGACCGTGAACGACGATCCGAACGCGACATTTTCGCAAGCGCAGGAG
ACGATTAAGCAGTTGGTCGCGAAGGATGTGATCCCATATATTCTCGAGATCGTTCGCGACAACCACGACAAGCCCGAGATGCTCTCGGTGTGGCTCGTCG
TGCTCAAGCAACTCGCGATCACGGAGGACAACTGCAAGAAGATCTACGAGCTCGAGGGTCTCGAGCTGCTGCAACAAGTCATGATCCAGCACGAGAAGCA
CCTCGTGGTCATGATGCGCTGCATCACAGTGCTCCGGAACGTCGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGCGCGTGCTTACAGGCATGCGGCTGCACTTGGGCGACCCATCGTTGCAACAACACGCNNNNNNNNNNGCCACACTCG
CCACGATCGCGCTTCGTGCTCCAGAGAACAGTCTGCGCATCGTCGATCTCGGCGGCGCGCGTCAAATCGCGTTCGCCATGCGAACTCACCGCGAGAACAC
AGCCTTACTGCGGCAAGCGAGTCTCGCGATCCGCAACATGGTCGCGCGCTGCGTGGAACTGCGGCCGCGCATCCTCGACGAAGACATTGAGCCGCTGCTG
CGCGATGCGCAACGATACCGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGACATTC
AGCTCTCGTCCTTCGGCTCTGTGGCCACGACCGCGCAGTTCAACCCAGTGAACATCGCATCCAATCAGTTGCTGGAGAGCGTGGACGAAGCCGCCGAAGC
CCCCTTTGCAGGACAGCGATAAGGTTCCAAATAGTGCGCAGCTTCAAGCACCTGGTATAGATGCCAGATGCTTGAATTCTTTCAATAGAAAACGACGCAA
TATACGATTATTAAAGAGAAAACAAATGAAGCTAGATTGTCGTGTTAAAGCCTTCAATACGCTTTTAACCAACGCATTATTCTAGAGCAACGGAGAGCTG
CACTCCGAATTTGAGGACGTATTTCGCCATCGCGCTTCCATCACCCCACTCAAATGCACCAACGTCGTCAAAGTTGCCCGCCGTATCTCTCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCATTTCTCCCTCTTTGTTTTTTCTGGTCTTTTTTTCTCCGGTTTCTTTCGCGACACATACAGCCACAGCTTCCCTA
ACGTTGCGTCTCGACGAACGCGCATGTTTTTGTTGACGTGTAGTGGTAGAAATATCTGATTTGTTGCTTCTTCTTGTTTGCGCTTCGGATACGATTTTTT
TGCGCGCCTACGAGATCGCGACCCAGCTTTGCTCAACGATCTCGCGCACGCGGCGATTGTATTCGCGGCGGTTCTCTTGGAACAAGCGCGCGGCTTCCGA
GTTCGCGGGCGAGTTCGGATTCGGATCGCAGAGTAGCGACTGGATCGACGTCAAGATCGCCGAGATATCGTAGATCGGCGACCACTGGTTCTGCAAAATA
TCGAGACAGATCTGGCCGTCGTTGTAGACTGTAAGAGCACACAGAGCCACAGATTTCACAGCGTTAATATCAATCCAGTATGAACAACAGCACCATAACC
AGCATTTGTAGCCTATAGCGCGGACGCGTGCACGTACTGTTTGGGTGGAACATCTTTGTGATAAATCGCACGGTTGGTGCTTTGTTCGGGTAATCTTCGC
TGAACTCCAGCGTCAGATTGAAAGTACCGCCTTCCCACGGCGTGTCATCCGGGCTAACAGCGCATAAACACACACATCACACCAAGCGTGCATACATACA
CAAGTCAGTCAGTTAAAGCGCTCTCTCTCTCTCATCAACGCCACACCAATTCAACCACAAGAGCAGCCACAGCGCCGTCGTATCCGCCAAATTTACTGCA
TACAGAGCTTCTCGACGACCCACGAGGTCCAATGGGTGGATTTCCCTTCTCTTCTTTGCCATACACGTACCCGAAGATGACGGCCTGCCAGAGCATGATG
TTGTTGTCCATGGGTGCGCCCGAGACGCCCGACGGCGGGTCATTCTGCAGCTTGCGGAAGTCGCGCATTAATCGTCTTCTAGCGGCCGTCGACATGGTGC
TGACTGCTTATGCTGGAGCTTCTTTCTTTCCTTCTTTCCGACTGTGCGCCAGTGTTGTTGTTGTATGAATGCGTCCAGTAGGTACGCGGTGCGGGTCGGT
GGGTCGGCAGCGCAGCAGTACCGTAGGCAACATTCTTGTACCAGCAACATCAGCAGCATAGATAGGTAGACAGACCAGACAGAACAAAAGAAAAATAATA
CCGGATCTAAAACCGGTATATTAATGCAAAGATCGGTATTGACTTTTTGAAAATGTACTGAGTTCTTAGGAGGTTGAAAAGGGAAGAAAGAAAAAAGAAC
CCGGTTCTGGAACTTTGGATTGTTGCTGCGCCTTTTTCTCATTTACTCATACATGTGATTGTAGACTCTAACATACTGAGTTAGATTATATCATAGCATA
ATATGTCGAATACGGTATGTGCATTGCAGAATGATAGTCATTCAAGCGAATCAACGTTCGCGACCTTTCGACGACAGGCTGTCAATGGAAGATACAAGGT
GGCGGCGGACGCGTGTGCGTGGATCCTCCAAGCATTTACCTCGAGCGAGCAGTTCTCAGAGCTGCTGCTGTGGACAGGTCCGTTTGACCCTTCATCCTGC
TTATCCATCGGAAAAGCACTGCTGCAATAGCGGTAACAGCTATAATTAGGCAGATCTGCTGCCCAAGGATTTGCTTTCCATGTCGAAAGAGCGGCTCGTG
AATCCAGAGCAAAATGTACGCGTGCTCGCGCGGCTGGAAGGCACGGGACCTAATACGATCACAGCTTTCTCGTCCGCGTATGATCACGAGTTTCCCAGCG
CACTTGACGGCATCGGTGAGTATTGGGTCAGTCCGCACGCTTCGTCTCTTTCCAGGCATGTGAGCTCTGACATTCGTCTGGTTGATTGACACGGCAGTAT
CCAGGAAGGAGTTCAGATTTTGCATGGAGATCATCAATCAGACAGTCGAAGACTACTACCCGTGTCTACCGTGCTACGCGTGCGGGTACTTTTGCTGCTT
CACGACGCTCGGCCTCTCGCTCTTGTTTCCAGAACCCTGCACGAAACAGGTAGGTGCATTCGATGGCGCTTGGGTGCCGTCATCAGTTTTTTGCTGTCAG
TCTGACGATTAACCTGCGTTTGTTTGCATATGCGCAGCTTGAGACCAACTTGGAGATCGTGCTGAAGCGACTGAACAACCGAGAGGAACTGCTATATCGA
GGCCTGATCTGGAAGTTCCGCCGCGACAAGCGCTCTCGAACATCTTGGCTCGAGATCTGTCAGATCATCTATGAGTAATTAGGTAACTCGGATTAGCAAC
ATGGAAATACCACAGTTCGATTTCAGCTCAAGACTGTCATTTTTTTCATAGACGTTTTGTACATTCTTCGAGTAGTGTTTACATGAAACACCGCTTGTTC
GCGATCTTCTTCTAGAGTGTCTAACAATTCGCGGATGGCTTGCTGTCTATATTAAATAATTTCACAACTGCGACCAAGAGGGAACTCTGTTTCCAAGCAT
GAAATAATGAGTGCAGCAACATGATGTTGTCTATCTAATGGGGGCTCATGGCTGCATTGCTTTTCTTCTCTTTTTCTCTTGTCGCGCTGGTCTCTCAAGC
GCAGCTTACTATGTCAAATACGAGAGGGTTTTCCTATTTAAATATATACGAACCTGGGTGCTTACTTACGATTTTTTTCGGGTGTGTCTTCTTTCTTGCT
GAAATGAATATCTTGTGGTCGGTCTTTTCTGGCGATGGCACTTCTTCTTTTCGTGTATCGCTACTGCTTGAAACTCGTCTTCTCTAAGTCGTCAGCACGC
CTTCGAACAGCATCACGCGGCTCTTGTTCAGCTCCTTGCAGACCACCTTCATATTCTTCTCGCCGATCATCGTCACCGTGCTGATCTCCTGGATCGACCG
CTTTGCATCCGTGTATGCTGCGACCAAGTAAATCACGGACGCAGCCACTGTAATCGGCGATTTTCCAGTCGAGAGACCGAGCGTATCGGCCTTCTTCGCC
ACGTTGTTCGCGATGCTCTGTGTCTTGAACGGCAAACCCAGGCGCGAGCAAAAGCGTCGCACGTACTCCTCTGTCGTCGGCTGCGTCATCTCGATGTCCA
AGCTTCGGTTCAGCGTCATGAACGATTTTCCGATCCGTTTCTTCGGCACACCCGACGCTTCTTCAAACTCCTTCAGCGATCGCGCATTTCCCAGCTTCCG
ACACGCAATAAACAGCACCGCGACCGGCATGCTCTCTTTCTCGGGGCCGCGCATGCTGATACCTTTCTTTTCGGCTTCGGCGTAGATATCCAACGCGGTT
TCCACGATGATCTTCGGTAACGCCATGGTATCCGCCACTTCGTGGACGCGGTCCATGCTGCGTTTCATGCGCTTGACCTTCGCACACTCCGACGTAATGT
TCGGACGCTTGTGCGCGCGTCCACTTCCACTTTCTGCGCCTCCAGTGGTAGCACTAACACTTGTCTTCCCAGCGCGCGGGTCCACCAGGTACGTCGTGAG
CGACACCTCGTTCAACCGCTGATCCGCCACCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATCGTTAGCAAAGTTTCTCCACTCGG
GGGTGTCATCAATAATGCGCTCACCGAGGATCATGCCGCAGTCTCTACACACGACGTCACCGGCCGAGAAG