Description :
From Genome Similarity Track
Location :
Scaffold_489:4495- 6313
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_489-fgenesh-gene-0.3Myb-like DNA-binding protein

Sequence
1818 bases(100 bases per row)
GCTGGTATGACTCGTCCTTGATGCTACCGCCAATCACATCTTCTGGAAGCTGCATGGTCTGGCGGTGCAGCTGCTGTTGCATCATCTTCTCCTGCAGTCG
CAACTGGAACTGCTGTTGCTGGATCTGTTGCTGCTGCTCCAGTTGCTGCGCGGCTTCATTTTGCTGCAGCAGCTGCTGCTGGTGCAAAAGCGCCAAGTGT
CGCTGGCGCTGAATCACGTTTGGAGGGTATTCATTCGACCCAGGCATCCCGCCGACACCGCCCATTCCATGACCGCCAAGCTGCTGGTCGTGATGGTGGT
GCTGGTTCTTCTTGTGCTGGGCGTGGGCCGCCGCGGCTTTCGTTGGGTTTTGCTTGAGAGACTTCCAGCGGATCTTGACCGAGTCTTCCGTTCGACCCTT
TAGCAGCTGCGCGATCTGCGACCACTTGTTGCCGAGACGTTCTTGCGCGGACAGGATGATTGTGTCCTCTTCTTCTGTGTACGAGCCCTTGTTAATTGCA
GGGTCCAAGTGGTTCTTCCAGCGTTCACGGCACTGCTTTGGCGTGCGGCCGGGGATGCGCTCGGCGATCTGGCCCCAGTTGTTGCAGCCCTGAGTCACGA
GGAATTCGAGCACCTGATCTTCTTCAAACGACCAGTGGCCCTTGACGAGACCAGGCTTGAGCACCTTGCGCCATCTCTGCAGGCACTGTGCATGGTTGCG
GCCAGGAACGAGTTCAGCAATCGCCTTCCAGTTCTTCTCGCCGTGGATGCGCACACTCTCACGGAGAGCTGAGTCCTGCGACTTCGTCCATCGCTTCGTC
GTTGGCGCATCTGGGTCCTCTGGGTCGTTCGAGCCTTCGCCGCCTTCTTCTCCCTCCTGAGAGTCCGAGAGCGATCCACGCGAAGGCGAGCCATTCGAAC
GCTCCTGCTCCGAGCGCGTGCGCTGCAGCGCCTTCTCCTCGCCCTTCACAAGCTCGCGACTGCTCTCCGGACGCTCACGCTTGCTGTATGGGTCCATTCC
AGCATCAGACGCGTTCTGCTGGTGGTGCAGGTGCGCAAACTTGCTGATCTCGAGCTCGCGCAGGTTCTGCTCCGACTCGTTGATGTGCGCGTCGTCGAGT
AGCTTGCCGACGCTGCGAATGTCCTCCTTCGTGATGTTCACCGACGACGATGAGTACGAGCGTCCGACACCTGGGCCGACGTCGCGTGCAGCCAGTGCCG
CAGCAGTCAGCATCATGTTCCCGCCCTTTGCAGTGTTCTCCTTGCTGTGAACACATTACCAGCAGCACAAATGGATTAGACGTTGTTGTTTCAGCTATAC
AGCAGCTTCCTATTCAGTCACATCACGTACGTTCCGACCACGGCGTTGGACGAGTGGAACTGCGCGGTGGCGTTGAGCTTCTTGATGCGTTGCACCGCTA
CAACAACAGCAAATACACACAGACATCATCACCATTAGACCACAGTCACGTGATGCCACGTTCTTCCATCCGTTCGCTTACCAGAGAGCGCCTCCTTGCG
CTTCATGTGCTCCTCGAGCTCCTGGTCCTTCTGGACCTGGATGACTTGCTCCTTGGCCTGCTGGGCGGCGAACTTGACGCGCAGGTTGGCGATGAACTTC
TTCTTGCCGTCCACGGTCGACTCGGCCATGGCGCGGATCACGCGGTACTGCTTCTCCTCGGCGAGCTTGCTCACGTACTTGCAGAGCTCGCCGCTCTCGC
CGGGCGACAGTCCGCTGAGCGACTTGAGGAAGAGCGTCGAGGCCTCGGTCGGCAGCGTGCGCAGCAGCTGCGCGAGCAGGTCGCCAAAGTTGTCCTCGAC
CGACTTGCTGGCGCTGGC