Description :
From Genome Similarity Track
Location :
scaffold_4:449354- 453952
Transcript NameFunction/comments
Plaha_PHALS_08586hypothetical protein PHYSODRAFT_325501
Plaha_PHALS_08587FOG: Transposon-encoded proteins with TYA%2C reverse transcriptase%2C integrase domains in various combinations

Sequence
4598 bases(100 bases per row)
TTCTCTCTCTTTCCGCTACTCTTCACGTCTGCTTCCCTCCGCTCACCtcaacaggttatgagcccaagcaaAGCCTCAAGCGACGACTTCCCGCGTCTTA
CTGGCGCAGAGAACTTTGATGTCTGGAAGGCCCGCGTGTGCGCTGCCCTCGATGGCAAACACCTCCTCGGCTTCGTGAAGAAGACCGACTACGACGGTGT
CCGAGGAAGAGAGCGAAGAAAGCGGAAGCGACATGTCTGACGTAGACGACTCGCCGAAGACCAAGCCGGCTGAGGATATTGATTCTGACGCCGTCGACTA
CGAAGAGAGCGACGACGATCTGAAGCCTCCGTCCGACTCCGATGATAAATCCGGAGATAGCGACTCGACGACgaaggagaagaagaaacCCTCCACCCGT
CCCCCTAACCGCCGAGATGCGAAGCGTTCTAAAACGCACGAGGCTCGACGCAAGCCTAAACCGCTCAGCCCTAGCGAGCGACGCCGCCGAGAGGCGAGGA
CCAAAGCGTTTCTTATGAAAACCATGGACAACACTCACGTACGCCTCGTGAAAGATCTCAAGACATTATTCGAGATATTCCAAGCGATCTGCTCTAAGTA
CGAAGGCGCAGCCTTTCATGGCGATCCGTACTTCATCCAGCACTTCCTCATGGATACCAAAAATACGAGGAGGAAGGAGACCTTGATGTTTTCTTTCTTA
AACTGGAAGAGGCGATGAACGCAACTTCGGAAGCCACCGAATCGATGATGACGGAAGGACAGAAGTCAATTTACCTGTTCCATGCGTTACCCAAGTCATG
GAAAGATGATCTCCGTGTTTGGAAGGGTCAACGGAAGTATATCCCGTATGGAGAACTAAAGGCCAACATCGAACGGAAGGTCCGCGAGATCCGCGCTGAA
GAGCGCTACACACGAGCCAAGGGAACGCCCGAGAGTCAAACGACGAAGAACGAGCGGGCTCTTGTTGCTCAGCCCAACTTGACTCAGTCTAGTGGAGCTA
ATGTGTGCACATACTGTGAGCGTCCGCGCCACAACATTCGCCACTGTCGCTCTCTGCAAAAGGATCTACGCGAAGGCCATGTGAAAGCTGGCACGGTACT
TCCCGCGAATTTCATGTTTAGGGGAGGCAACTTGAGCCACAACCACCCGTACCGCCAAAACAACAAGCGATCTAATCGTGGCCAAAGCAACCGTGGTGGA
CGCAACAACCGTGGGTACCGTGGTGATTGTGATCGACGTGACAACCGATCTGACAAGGGCCGAGCCAAAGACAATTCTGGCGACAAGCGCAAGGAATTCA
CCCAAGAGCGTCGTGATGTCGGGCTTATTGCTGTTGTAGCAACTGTGCATCCTGTGATCAGCCTGACTGCCCAAGCCACTGCCAGCCCCGAACCCACCtg
gacaatcgactctggatGTACGCGTCACGTTACGCACGAATCCCAGTGGTTCTCGACCATATCCGCGAGCAACGGTTCAATCACCGTTGGTGTGAAGAAC
CAAATCCCCATCGAAGGAATTGGCAAAATTGAGCTGGAAGTCACTGACTCCAAAGGCACGCAGAGGATGCTTACCCTCCACGATGTGCTGTACGCTCCTG
AGCTGAAATTCAGCCTTCTCTCGGTACCGGCGGCTGTGAAACATGATTTTCGCTTCAGCTTTGATCGCAAGCAATGCGCCGTGCATACCGAGCCGAAGTT
CAAGATCAACGCAATGATGGCAACCCATGCGGATCTGTACCAATTCCAGGCCAAACCTGTGATGAAACATGAGGCTCTAATCGCCACCTCAGGTAAGCAA
CGATCCAATCTGCTTTTACACAAACGACTCGGTCATCCTAACGTACGCATTTTGCACGATTTATCTAGGAGCCAAGCCATTAGTGGTCTAGACAACGACT
CATCTGTCGACCCAAAAGCTCAGTTCTTTTGTACTGCATGCACATTAGCGAAGTCTCAACGCTCACCGTTTAATTCTAATAAAAGTGTTGAACGTGCCAA
ACATCCTTTACAAAAAGTGCATACAGACATTTGCGGTCCCATGCCTGTTCCCAGTCTTACTGGACGCCGCTACTTTCTCATCGTTGTTGATGACTACTCT
CGGTACATGTTTACGTACCCGATCACGAATAGAAGCGAAGTATATGAGTGCTATGAGGACTTCAGTAAGAAAGCCCTGAACATCTTTAGAAGCGACGTCA
ATGTCCTTGAATATCCGCAACCTACTAAGAAGTGTGACATTCAGgttctgcaagcagacaatgCAAAGGAGTACGAAAAACTCGGGCGCCAGATTTTCCA
GAAATACTGAACACATGCGCAGTTTACGAATGCTTACACTCCTCAACAGAACGGTGTCGCCGAACGACGCAATCGAACCATTATGGAGCGCGTTCGAGCC
CTACTGCTTGATGGCAATCTGCCGAAGCAATTGTGGGCGGAGTGTGTCTGTCATGTGACCACTCTCGTTAATATGACACCCAGCTCAACGACTAACGGCC
GTACGCCATATGAGCTCTGGTACAACCGCAAACCATCCATGGACTACATCAAAGTATTCGGATGTAGTgcctacgcacatatcacaGAACAGTATCGTGA
TAAACCTGATGCGCGAGCACGCTTATGTATGTACCTCGGTCTCCCTGAGCACAAGAAAGGCTATCGCCTCATGGCCGTAAATACCCATGCCATTGTCTAC
AGCCGTGATGTAACTTTTAGAGAGGACGAATTCCCTCGTTTACAGACCTTGACAAACACTGAGCAATCATCACAGATGCAACAATCTAGTACTGTGCAAA
CGAATCTTCTTGCACCCCGACCTGcaacgacatcttctgcagcGCTGCCCGTACTGTTCCCACTCAGGGAGGCTATTAAACGCACACATTACACATTTTG
TGGGGAGACGATATCTGATCCTCCTTCTTCTCCTACGACTAAGAAACCCCATCTCGACACCGTCGACATGAATGTAGCCCTCAACTCTGAGGAAGACTTA
CAGGAGCAAAAGCAGCGCAGGTCATTACTGTACACATTACTAGCTATTCGGTATGTTACAGAGCCCACTACGTATCGAGGTGCGATGAAATCCCCTCACG
CTAATCAGTGGCAAAAAGCAGCCAAATCGGAATACAAGTCCCTCATGGATAATAAAACTTGGGTTTTGGTATCTCCTCCGAAAGGACGGAAGATTTTAAC
CAGCCGATGGGTATTtgttgtcaaatacaccGGCACAGTGCGAAATTGACCGCTTCAAAGCGCGTCTGGTGATCAAAGGTTTCCTTCAGGAACATGGCAT
TGACTACAACGAAATTTTCTCACCTGTTATCAGGATGGAAGTACTTAGACTCGTTCTCACGATCGCAGCCCTGCTCGATCTAGAAATCCACCAAATGGAT
GTCAAGACGGCATTTCTTAACGGTTTTCTGGAGGAGGAGATCTACATGGCTGAACCGGAAGGTTTCAAAATCCCGGGTAAGGAACACCTCGTGTGCAAAC
TCCTGAAGAGCCTGTACGGGTTGAAACAAGCTCCTCGTGTCTGGTACCAAACGTTGTCCGCCTTTCTTGAAGATCTTGGGTTTACAAAGCTCATTAAGGA
TCGTTGTGTATTCGTACGCACTATTGACGGTGTCACCTGCTATATCGCGGTGTACGTTGATGACCTTTTGATCATTGCGCCTACTCCAGCCCTTGTAAGT
GAGCTAAAATCAGCCCTGAAAAAGAGATTCTCCATGATAGATTTAGGGGAGGTGAAGTACTTACTCGGCTGGTCCATTCAACGTGACCGTAAGAACCGAA
CGATATTTATCCACCAGCACAAGTACGCTACGAAGGTCCTTGACCGTTTCAGCGACTATATTCTGTACCCAATTGCAACACCAGCAGAACGGAACGTAAA
ACTCTCCGTAAGCAGCCAACGTAGCagtgaagaagagaaagatgCGATGAAAGAATTTCCGTATCGCGAAGCCGTTGGTAGTATCATGTATCTCATGGTA
GGCACACGACCTGACATGGCATTCTACATGCGTGAGGTCAACCAATTCCTAGCTAATCCGGAAATGGAGCACTGGAAGGCAGTTGTCAGAGGTCTTAAGT
ACCTTTCAGGAACGAAGGACTATAGTCTTCTCCTTGGTGGATCACTTGACACCACACCAGACAATCTTGCCGACAGCTTGACCGCTTACAGCGACTCCGA
CTATGCCAACTGCCCCGACACGAGACGTTCTGTCGGTGGATATGTGACTATGTTAGCTAGCAGTCCAATTTCATGGCTTTCGCGCAAACACCACACTGTG
GTTATATCAACAACAGAGGCAGAATACATTGCCCTGTGCCACTGCATGCAAGAGATGATATTCCTCAAACTGCTCCTCCAAGAGttaggttttgctacga
TGCAAGCTAACTCCATTTATGAGGATAACCAGAGCTGCATCAAAATCTGCTATAATCCGGAACTTCACAGACGAACAAAACATATACACGTACGCTATTG
cttcgtacaagaaaaagttgAGCGGCACGAATTCTCCGTCGCCTATTGCAATACCAAAGAGATGGTGGCTGACATCTTTACAAAAGCTCTAGATAAGC