Description :
From Genome Similarity Track
Location :
scaffold_555:4493- 5887
Sequence
1394 bases(100 bases per row)
GACTGGTAGTCGACAGCACACTCAGGAATGCAATCTTGCTCTGCGCATCCAATTTGACTGAGCGATTTGTGGTTCGCAGATGAAACTTCCGGAACCGCTC
CGCGTACCCCTCGACGTACTGGCCATACAGTTTGACGCATAAATATTCCAATTGTTCATTGCGTTCGAGCATATTCAACACCGCTTCTAACTTCCGCTCG
TGTTCTGGGACCCTTTCATCTGGACCACGCGGGCTATATGGATAGTCCTGGTGAATGGTGAGGCTCAGCAAGCAATTAGAAAGAGCGCTGTCTGTATCCA
TCAGCTCTTCAGTAAAAGTCAGAAGATCGCCCAAGTTGAACGTAATGCCTGGTAGTGGTGAAGCAGCTGCGTGGTACTCTGAAAAATCAAAGACAGCAAT
GTCATGATGTCTTTTAAGGCATAACTGCACCAAATTGGGGCACCGTTCAAGGACCATTTTCACATCCACGACGACGTCGACGTTCCCAGTGTCAATTGTT
AGCATCTTTAAGAAAGACCCAATAGCAGCAAAGAAAAGTGGGAGTCCACTAATATCAACAGTTTCACCAGGGAAAAGCTCATTTCCCCCGAAATGAATCT
CGAGAGCTGTTAAGTTATGGGCAGGAAGAGCGTCGACATGCCCGCTAAGCACCAGATTTTCACGTCGGACTTCACAGCGACCATAACCAGGAACGATAGC
ATCCACCCACTCACTCTCCTCACTTTCACTCAGAATCTGCAAAATTGGAATTGGAGTACCAGACTTTAAAACTTCCGAATCAAGAACAGGCTCATTCTGC
TCATTCATGAACCATCGGATTGGAGAATTTGCTGCCAGAGTCGCATCTTGTACGCCACTAAACCACAAGGGAATCCGAGAAGTGCTTCTTCCGGGTGCTC
AGATGATAAGATTTCGCAAAACGCTTCGATCTCTGCGGTTGCCATCTTTTCAATGTGTTTTAAAGCAAAACTTTCCAGAGAAGAAAGGGTTCGAGCTCGT
TTGGAGAAAAACCCGTAAGCTAGCCACTCCCACCAGTGTTTTGAACGCCAAAAGGAGCTCATATACGCGAGTTTCAATTCCCGCACGGTTTGACTTTGTA
TCGCTGCTGAGCATAATGCTCCCCATTCGGTTAGAGACTGCTCCTGCAGTTCTATTGACACCTGGTCGAGTTGCTGGTGTGTTATCAGTGCCTGCCTTTT
GCTTTCCAAGTGTCTCGTTGGCGATTCATACGAGCGACGAGTACTATCAAAAACATTCCTCAATAACCGCCCCAGTACTTCCCTCCTCAGCCGCCCATCA
CTATCGCCCAAATCCAAATCCAGAAAAACGCACGAAAACCACACGTTGTCGTGGACCAACTCTTCCATCGTCTTCGCCATATCCAAGTCAACTG