Description :
From Genome Similarity Track
Location :
Scaffold_895:4492- 8690
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_895-fgenesh-gene-0.0Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_895-snap-gene-0.5Cell division protein ftsZ
Pytve_DAOMBR484maker-pve_contig_895-snap-gene-0.6Cell division protein ftsZ

Sequence
4198 bases(100 bases per row)
GCGCCATGGACGGCATGTTCCAGAGCGGCGTGCAGGTGTTCATCCCCGCGGCGCTCAACCGGCCGACCCACACGCTGTACAGCATCACCATGGCCGTGCA
GCCGACCGCGCAGGAGTGGACGGTCAACCGGCGCTACTCGCAGTTCCTGCAGCTGCGCAAGGACGTGATCGCCAAGCTCTCGACGCGCGGCGTGGGCTGC
CCTAGCTGTGCGAGCTTCCACCGCGCGGTCGCCACGTTCGCCTTCCCGCGCAAGTCGCTGCTGCACACCAACTCGGTCGTGCGCCGGCGCGTCACGATGC
TGCAGGACTTCCTCAAGATGCTGGTGCAGCGCGTGTACAACGACCTGCCCAAGTGCCCTATCTGCGGCGAGGCCATCCAGAAGATGATGCGGCCGTTCCT
CATGCGCGGCGCGCAGCCGCTGCACGGCTCCATCCTGCCCAAGATCCAGAAGTCGCTCTCGCTCGACTCGTACGCCGTCGTGCCGCACATGCAGGGCGTG
CCGGCGTCGCCGACCTTCTTCTCGTCCAGCCAGACCAGCGTGGCGACGCCGCAGGACGCGCAGTTCGCGGCGTCCAAGGCGGCCAGCTCCATCTTCTCGG
CGAGCTGCACGTCGGCGTTCGCATCCAGCAAGGGTCCGTCCAGCAGCAGCTCCATCTTCTCGATGACCAACCCGCTGGCGTCCAGCAAGGCGCCGAGCCA
GGCGAGCACGGCGTCGGACGCGTCGACGCAGCCAAACGAGTCGGAGGACCCGCTGTTCACGGACGCGGACGAGGCCCACTACGCGCGCAAGTACGACGAC
CAGCGGTGCAATGACCCGACCATCCCGCTCGAAGAGGCCATGAAGCAGGTGGTCATGCCAGAGGGGATCCGGTCCACGGTCGAGGAGGTCGTCGTGCGCC
TCACGTCCATGTGGGCCGCCTACGACATGGAGGAGACGCTCGCGTCACTGCCACCCGAGCGGCTCTCGCAGCGCGTGTCCATGTCGGCCATCGGCGATGA
CGAGTACTCGTTCTGATCGCCGTCGATCCGCCAGCCGAATAGCTTCTAGCCGCCAACCCCGTATTATAAGCCCCGCGCTCGGTGTGCATGGATGCAGCCG
CGCGCGTCGCTGCCGTTTTGAAGGCCCCGGTTCGAATGACAGGCCGGACTGTAGGATCAGCAGCTCGGTGCTGCTGCTCCCCGTATAAACTGACGAAATT
GATCGAAATATCTCGCGTCCGCACGGGCGATTCAACCACATTGCATATTCCATGAAAGGTGCTTCACCGATACCTGTCCTCGGTGTGCACGCAAGCGGCG
AACAATCTTCTGCATTCAGAATGTGGGGGCTCAACCGCCTGACATTCATCGACTCTTGCGCGACACAACGAATAAAAAAGTCTACCCGAAGTTTACCTTC
TCGGCACTGGTGTTGTTGCTCTATTACTTGTCGGGGTCGGCGATGCCAGTCGCAACGACCGACACGCGCATCTTGCCGTTCAAGGACTCGTCAAACGTCG
AGCCGAAAATAATGTTCGCATGCGGGTCGTCGAGTTCCTGGTGGAAGAGGTGCTCAAAAGTTAGATCCAATGTGCGAGTGACTGGTTTCCAGCAGAAATA
GCTCGCCACCAACCTGCGTCACGCGGTCAGCGGCTTCATCCACCTCGAATAGCGTCAAGTCCGATCCTCCCGTGATGTTGACGATCATGCCCTTGGCATC
CTGATCACACACACGGAAGCATCCCAGAAACATCATGTGAGCTCGCATCAAAAGTCAAACTGTGATGACCAGAACTAAGGCAGACCTTGATGGAAATGTC
GCCAAGCAGGGGGTTCGCCAACGCTCCTTCGGCAGCGTGCAGAGCACTAGCAAAAGAATCAAGTCAAAACTCCTGGTCTCGGCTTCTAGCACACTTTTGG
AGGTATACACATACCGATTTTCGCCAGCTGCTTCGCCACTTCCCATCATGGCATTCCCCATGTTGGTCATGACCTAGCATCGCACGCATGTGTCCAACTG
TCAGTGTCGTCTCATTCTGTGGCAATCGGATGAACAAAGTGACGCACCGATTGCACGTCGGCAAAGTCCAGGTTGATTAGTCCTGGCATCACCATCAAGT
CCGAAATGTTTTTGACGCCGTCGAGCAGCACGTCGTCCGCCATTCTAGCAGAACGAGATACCAAATCATCAACTCAAAGTCCCATCCCAAATCCAACACA
CATGACCACTAACCTGAACGCCTCTACGAGGGATGTCTTTTCGTTCGACATGTTGAACAGGTTCTGGTTGGGAATGACGATCATCGTATCCGCGGATTGT
CGCAGCTCGGACAGCCCTTGCTCGGCCAACTTGGCCCGATTGTTTCCTTCAAATCGGAATGGCTAGCGTACATAACCGACTTGGGTGTGAGCACAGATAC
AATGTGTGTGCGAGCACGGTTGAGCAACCCTCACCTTGGTGACAACAGCAACAGTGAGAATGCCAGCATCAAGCGCTGCCTGAGCAATGACTGGCGCGGC
GCCAGTTCCTGTTCCACCGCCCATTCCTGCCGTCACAAACATCTACTCACCCACGAAGACATGAGATCGTGTTCAAATGCTCAACGGTGTCAAGTGGCAC
CGTCTCCGTCAATGTTACGCACCATGTTCGCTCCGGCAACCTTCTCCATGATCTCGTCAATCGCCAACTCCGCCGCCTCACGACTGCATCATTGAGACAT
ATACAACGGACATTTCATCAGTGCCTCATCCAGGGTGTGCTGATGGCTCAACAGATATGTAAGCTTACCCGACATCAGGATTGGCTCCACATCCGAGACC
TCCCGTGATCTCCGGCCCCATTTGCACTCGGTTGTCGGTCAGCGTCGTACGCAGATGCTGCGCGTCCGTATTGCACACCAAGAACTCGACGCCCTGCAGC
CCGCGCGCGATCATATTGTTCACTGGATCCCACCACCAGCTGTCAGCACCACAGAATCATATCCACTTGAAGTCGATTTGGAAACGCGGCTTACCAGCAT
TTCCCCCGGCGCCGCCGACACCGACGACCACGATCTTCGGCGCGAAGCTCGACACGTCGGTCGTGAAGTGGTTCTGCTGCAGCCAGAGCGGCTGCATGGG
GCTCGCGGCGGGCACTTCCACCGGTTCAAGCACGTCAGCCGCACTCGGCGCATCAACCAAGACCGACTCCTCCACTGGCGTCGGTTCCTCCACCGGCGAT
GCTATCGGATCGTCCTCTCCTTTCCGCGTCTTCTGTTTGAACCCCTACGGAGTCAACCATCCGTCAGCTAGCGCTCCAAAGCTACAAGGTGGCCAAACCA
CCAGAACGGAGCGGATCTGCAGGGTAATCGCGCTTTTACCATCCGAAGAGCGGCCGCCGCGGNNNNNNNNNNNNNNNNNNNNNCATCAGTAGAGAAGGCA
GCACGCTTCCACCCACAGCCGGCAGCTCCCATCTGCCGGTGGGCACGCAGCAGCGTCGCCGCCGCGGCTCGAACACGCAGCATCGGCATCTCGACCGGCT
CAATTCGGTGCTTTGGTCGACTTGACGCGCATCGCCCAACATCCATCGAAAAACCTCGCGCATCCAACCTCATGAACGAGGTTATTGATGGATACACTTG
GGTTAAATGATGTCACTCAAACGATGTTGCCACGAAAGAGTGGCATTCGAACTTCAACCTATATGGCTACAGTCGCTGAATCCTGTTGCTGTTATTGCTC
GAGCGAGCGGAGTTCCTCGACGTTGGCATTGATGTGGAGCAGCACCTCCGTGTCCGATAGATCTAGCTGGATGCCATATGTGCGCACGGCGAACGTGGCG
AACGTGTCGGCGTCGGAGCACAGCAGCCGCCCCGTGTCCGCCCAGATGACGACATCGCAAATCACCACGCCGCCTGATGTTGGGAGGTTGAACCTGCTCG
ATTGACCGTCACCAGTGTGGCTACATTCGTCTGTTGTTGCTAGCACTGTAAATCGTACCCGTACAGACGTCGGAGCTCGGCGGCCTCGGTCACCCACTGA
TCCGGCCGGTACGCGCGCTTGACCACAACGAAGTTGGGCAGGGACGTCGCCATGATATCTGTCGAAATACCAGAGTTCTTAGCGTGACACCAACTTACCA
ACTCATGGTAACCGCACGTGACCTACCCAGTAGGCGACCGCAGATTGCGAACTCTTCGCTGTTGACGCGGCCCGCGAGCGTGTACTGCACCATCGTGA