Description :
From Genome Similarity Track
Location :
Scaffold_455:4492- 8543
Sequence
4051 bases(100 bases per row)
TTCGATCAGACACGTTGGTCAATCGAATGCTCTGAGGCCGTCCACGTCGAAACCTCGTCACTGACGGGATTAGCTTGTTCGTTCGACGAACCCACAGTAC
GTGTTCTTCCAGCCCGACTTGACGCTTCGCTAGTCGATATTCTCGCCACTCGTGCGCTTGAATGTCCAACCGCTCGGGTGGCCCGGCGTTAACATGGGAG
CCGTATTCTTCGCTGTCGATCATGTTCTTGGTCTTTATCAGCGGGATTTGGACTTCGTGCGGTAATTGCGCCGCGCCGTGGAACAGGTCCAACCGGATCC
CAGCTGGGATCATAAAGTCGGTCCCGAGTACCACGTCGACGCCTGCACTATGCGCCATTACCCACATCTCAAACTCGTACACCATCTCCCATCCGAGCGG
AATCTTGACGCACGCTCGTCGCGTCGTAGACACCTTGCCTTCGTTGATTCCTTGAATGTCAATGCGGCGTCCGTGATCAGGTACATCTCGGAGTCGCAAC
TTCTTGGCAAAGGCGTCAGTGATCACACTAACGTTCGCTCCTGTGTCGAGGAGGATCCTCGTTTGCTGGTCGTTCACAGCGCCTTGCACCAGAGCTCTCA
TTCTGATCCGTCGGTCGAATTTCTTGGCCGACCACCAACCCTGTCTCTCGCCAGGGTTCAACTTCATAATCTTGGAGTGACCCTTGGACTCGTCTCGCGC
TGCACTCGAAACCAAGCCGAGCGAACCCTCGCTGGTGCCCTCATTAGCATCAGCACACTCCACTCTCTCTCCAACACCTCCACCGAGGATTCTACTCCTC
TCCTTTTCATTTTTCGTCGCGTTCACACTTGTTACGTAATTATCAGGCCATTCACTCTGCCCCATGAAAGCAAAGATACACTCTGCTTCCATTGAAGGCT
CGGTTAACTGTGGCAGCCCGATAGGGACCAACCCAGTTGTAGTTGGCGGGCTGCCTAGTTTAAATGACGTTCTTGAACGACGGCCCTGAGCTCTGGCGGG
AGTTCCTCCTTCGTGCCTTTAGTGCGCACGAATTTGGCAAGGTCTTGGAAGTTGCGGAACAGTTCGCATTGTCCAGCATCGTGGAGCTGCTTGCAGAACT
TGCATCGCTTGTTACAGTAGTGGGCGGAGTGACTCATGCCACCGCACACCGCGCATGGTCCGTACTGTGGGCGTCGGTTGTCGCGGTTGAAGTCACGTCG
ACCGCGTTGGTCCTGATTGAACCCACGGTCACCACCTCGGCGATCTTGATTGAAGCCATTATCGCGATCAGGCATGTTTCCACGTGGTTGACGGTTGTCT
GAACGTGCGTAGGTGCCTTCAGCAGCTGCACGGCGCTCGTTTTCGTTAGCAGCGGCGAGGTATCGGTCGTTTTCGTCCAATGAGAAATCACCGTCCGTAT
TATCAGGCTGAAAGTCGTTGTACTCATCTTGGACATCGTCGTAAGCGTTCGGATCTGCGTTTGAATACTCGGTGCCTCCCTGAGCAGCTTCACGACCTTC
TAATTCAGCTAGTAGGTCGTCCACCGTGGCTTCAATGAGTGTCACTCTTGGTTTGTTGCGGTTGTCATCGCGGCGACGGTCATCACGCCGGTTGTTGCGG
GCGAATCCATCGTCGCGTCGCGTATCACGACTCTTGGAGTATCGGTACTCACTGTCACGCTTGGCCATCCTCTCCTTGCCCTTGAGAACATCTTCGATGA
TCTCTTCGAGCTCGTGAATGTCGGCGACTCGAGCGTGGTAGAGACTCTCCGCCAGCTTGTCATCATCGCATGTTGCCAGGAACTGCTGTACGTGTTCTTT
CGCGTCACGACCACTCTTCTCGAAGTGTAGACGGGTGGTCCGAGCATAGCCATTCAGCCTGTTTATGTAGTCGCACAGATGTTCATTACGTTCCCGCTTG
GCGGAGTAGTAACGCGACAGTGCCGTCTGCGTGAACTGCGAGCAGTAGTAGCGGATGAACGCATCGCTCAGCAGCTTCCACTTGCGCTTCGTCTTCTTCG
GAAGTTGACGGAACCAATGAATGGCTCCGTCCCGGAGACTTAGCTCAAATGGAATGCACCATTTATCGGCATCTGTGTGGGTTCCAGTCATTTCATAGAC
GAACCCACGGAGCCACTGCATACAGTTCTCGCTCTTGTTGCGAGAGCCTGAGAACGGCGTGATGCGATCCAGCGGTCGGTGCGAGGCCATTTCAATCCTC
GGTGTTGGGTCCACGTCGTTCAGCGTCGCTAGCTCATTCATCTGACGCATCAACTCGAGTTGAGGATCTTTCCTCGTCGAATGTACGCACCAAAATGTCA
TCGGTCACTGGACGAACCATCGCTGTCGACTTGACGACGTCCGGCACTCACCTTTGGGAGCTCGCGCACCGCCTTTGGCGACCGAACGAACCCTTCGGTT
ACTTGCGTAAATAACGTTGCATACGGGCTCTTCCGGAACGTGGCGGTAACCAATGGTGCGGAGTCCTTGGAAAGGTAGGTTGAAGCTTTCGGTTAGTGCC
AAAGTTCATCACGCTTCAAGCTCCACGCATAGATCGGAGGAGTACGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAGAGGGCACCTACCATCCTTCCTTCATAGGATCCACACCCGATCCACTCTTGTATAGTATATCCCATATC
CATTTAGGTGAATCCAAGTAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCTTGCCTTCTCGTACATCGCTCATACCAGATCCATCGTCACTTCATACGG
GGCGCTGCTCGTCATGGCTAATCCACCACCGGCAACTTGCATCCGTGCCAGCCAACCCAAATCCTTTCTAATCACTTGAAATTGTCATTGATTCGGGATA
GTGACCCCGCGTCAGGCCCATTCTCTTATTTCTGAGAAAGCACTTTACCACAAGGCCATCCATGAAGACTGTTGTCTTGACGTCTTCAGGCAGAGGATTC
CCTGCCAGGATGCCACCAACGTGCTGTGGTGTAGTGATTTCTCCGTAGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGCCCAAGATGTTCAAG
CAACGAACCCTCGGTCATGTGATGTACGGAGACGCCAAGGTGCAAGGGACTCGACGGCGTCACTACCGAACTCTCAACGGATATTGGATACGGTCCATAT
GTCACAGAATCCAGGCTGTCCTTACTAATAATAATGAACTGGTCGGATTCGCATTCAGCCATCTACGGTACGAACCCTCGGTGGCGGTTGGGATGAGTTC
GCGGAAGACTCAGCGACCCTTGGAAGACACATTCACCGTCTGGGACAGGGCGCGAACCGTTAAAGATGCTCATGCGACGGTGCAAACGACGCTTGGCATG
CAAGAAGATCCATAACGGATCATTGTTCACTTGATATATGTATATTTGATTAGGACTTCTTATTAGGAATAGACCCGAAAGGGTAAGCTTAAATACAGAA
CAGAATTTCCACTCAAGCACACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCTGGTCAAGCTTTTTTGAGTGTGTTATGCCTGTCGGTGAACTCGAAGCT
CTGTAGCGAGGGTTCATCCGGCAAGGCCAAGAGACTTTGTGTATTGGCCGATTACTATCGGGTGGTTTTTACGTGACGGCTTATTGTTGCCTATTTGCAC
GACTGGGAGTGCTTGTTTTGAATCCCTTTTATTCTTCCAGCCGAGTGTTGAACACTCGGTGATCTCGTAAAAGGCTTACCCGTGCCTGGTACCCTTTCCG
CTGTTGGGACCACGAGGATTTAAAACACCTGCTAGCTTTGCTCGTGCTAGTAGCGTATTCTTATTTTTACTGGCTGGCCTATATAAGTAGTTTACAAGGT
CCAGTTTGTCCCGGTGCAAGGGCAGAACTGGGGTCTTCAGGTCCGCCCGAA