Description :
From Genome Similarity Track
Location :
Scaffold_610:4491- 9208
Transcript NameFunction/comments
Phyag_g6995conserved hypothetical protein
Phyag_g6996hypothetical protein PHYSODRAFT_295452

Sequence
4717 bases(100 bases per row)
TTAGAGCCCCAGGGGCTCGGCCTCgacttcctcctcgctcttgACGTCGCCCTTGGCCGGGAGCTGCGGCgggtcgtggtcgtcgcaCTGTGTGACCCAC
TTGCTTTTCACGGGCATGATGTGGCAGTTGATGCGCATGACCTTAAGCCCCTTGGTGACCTCCAGGTCCACCTGCGTCCAGTTGTTGCGCTGGTCGGGCA
TCGTGCAGATGTGGCCCACCTTGGGCTGTCCGCAGCGACCGCACTTGTACAACTTCCGGTtcgcgtcgtccatggctgccttcttgctgcctgATGAGGA
GGCAGAGGTACTTGCACTGCGTCGTGGCGGCGATCGGTGCTGGTTGAGGTCGACCATGCTCGGTTCCTCGGGGACCGAGAGGAATCCCAGATTCATCTGG
GACATATCCATCGACAGCCCCGACGAGCGGTTGGCACCACGcctgcgagctgctgcacgcggCGGCAAATTGCTGCCGAGAGACGACCGACGGCCATGCA
GCGAGTGCACAGCACCACTAGCGATCTGGGGCGGCACCTGGAACTGGTACTGCTGCATGTTGGGCTGCGGTGGAGCCGGGAACACTGTGGGGTCCTGGAA
GCTGGCGAACGGATTCGGGTACCCTTGATTCGGGTTCatgttctgctgctgatgctgctgttgtacTTGTTGTTGCATCtgtacctgctgctgcttggtt
tCCTGCGACAAAATGCGGAACTGGTCCAAGTTGTGTAGCAAGTCGACAGGGTTCGAGTGGTGTCTTGAGTGGTGGTTCACTGGGCGTTTCCGCTTCATTT
TGAGCTCGTTTACTCCTTCTTGAATACGCTGCGAACGATAGGCTGCAGGAGACGCTCCTCCATTGGGCACCCCACTCccgtccgtcgtcgcggCACTTAC
CACCGGCGCCTGTGGCtgtagttgctgttgctggtccGGATTAAGCTCCGACCACGATAATTCCTTCAAAAACTCATCCATCTCCTGGAACGACTCTCCC
TGGGGCGTCCCGGTACCTCCAAAGGGCATAGGATTAGCTGGCGAGTCCACCTTGACGGGTCCAATCGGCATAATATTGTGTTGCTGAGCGAACCCCATCC
CATTGGCCCCCATAACGGGAGTCGTGATGACACTGGGTGCCATATTGGCTATGCCAAAACCCTGCAGCACGTCCGGGTTGGAACGAAcgcgcttgtgctt
gtgctgcGGGGCCACGCGGTAGTTGGAGCCTCCGGCCTGCGTCCCGTTCGGattgaaggagaaggagagcgGTGTGAGCAGATCCTCGCCCTCGGCCTTG
GGCGCCATCATGTTTGTGGGCGATGAGCTGGgcacgtcgctgtcgagtAGCATTTGGTCGTCCGGCATCACGAAAGCGCTGGCCGAGGTGGACGcggcgt
tgttgttgccgctgctgccaccgccgcTGCCCCCTGCGTTCATGGAGCCGTCCGCAGGtgcatcaccaccgtcgaGGAAGTTGTAATCGAGCGGCAAGCC
GTCGAACAGGTCCAGCGTTTGCGCGTCCGCCATGGGGGGCTATAGGGAGAATGCTATAGGGACGGCTtctcttcttgggcttcctATGTGAAGTGCGAAA
TTCGGTGTGCGGACCCACCTACCTTCTAAACTTGATTGTATCCGGATACCATGTTACAGTAGCTTGGTCATTACCAGTGTAGACCTCTCAAACGTTCTTC
CGGATATCGGCATTCAATAGCGAGTAGCGAATTGAACCTAGCCCTGATCTACCAGATGCGGTTTGAAACATGGCTACAATTTGAGGCTGGCAGTCACTGA
CACCACCGCCGACGAGAAAATGGCAACCAGTAGATTAGCCCCGCGGACCGCAAACGACATCTTTTAGTTTATACATACCTATGCGGAGAATTAGAGGTTG
CTTTTCTGCTTGCTCGTCCGTTTCAGTGCTACAGCGCTTGTGAGTGTGGGAACGCCATCGTCGGCGGGTTGCCGAAGCTTGAGGCACCAATCTCGTACGT
CACGGTCtccgtcgactgctgctccaccgGCTGGTAAAAGCTTGGGTCCAATGCggcagctcgtgcaggatCTTGCAACAGCGCCTGCAGAATGCACGCG
ATCGGCCGTCAGCAACCAATTTTAAGCTCAATTTGTCCCTGCAGGACGTAGCCACCGAAGCAAGCCTTCCACGCTCACTTCATCCCCTGCAACAGACGTC
AACGCGACGCGGCGACGGCCTTCTTAGAAAAGAAATTCACTCACCTGCAGACTCAGCGGGCTCAACTGCGACGTATCCTGTCGCGGGTATGGATCCCACA
TGCCTGCACCATTGGCGCCGGgttgctgaggctgctgatTGTCGGCTATCCTGGGCATACCGTCTTGATCAATCTCGCCGTTCGTAGCGGGTACTGCAGG
CTGGAGCCACGTCTCACCGCCattttgctggtggtggtcgctCTGATGCGCAGGAGACGCGCTTTGGCTACCAGCACCAGTCGAAGTCTGTCGTTCGTAG
TACCGCGGGTCATAGCCATTGTTCGCGACGTAGTCCTGACCCTCATACTGCTGCGGCGGGGCATAAGACTGCTGGGCAtaggcagcagcggcgtaCAAAT
TCGGATCACCACCAGGAGATTGGCCCATTAGCATAGAACGATTCTGCTGGTATGGTTCCACTTTCAGGTCCTCTGTGAGCATGGCAACATGGCTAATGTG
TTGGCCTTGCTGCATTTGCGCCTGTTGCTGCATGAGTTTCTCGTGAAGACGCAtctgctgcatttgctgttgctgatcAAGCTGCTGTACTGCTTCGGCG
TTGTGTGCTTGgagatgttgctgctgctgcaagagttGCATTTGTCGCTGCCGCATCAGTGCCGAGCTGTTGTAGCCCATTGCCGCCTGTTGcgctgccg
cagcttgtgcttgttGCTGATTTTTCTTGTGCTGTGCgtgagaagctgcagccttgCTCGGATTTTGCTTCAGCGATTTCCAACGGATCTTCACTGAGTC
CTCGGTGCGTCCCTTCAGAAGCTGCGCGATTTGGGACCACTTGTTGCCCAGTCGTGCCTGTGCTGTGAGGATCACGGAATCCTCTTCTTCCGTGTAGGGG
CCCTTGTTGATGGCCGGGTCGAGGTGGTTCTTCCATCGTTCACGGCACTGCTTGGGTGTACGTCCCGGGATACGCTCAGCGATCTGGCCCCAGTTGTTGC
AACCCTGCGTCACAAGATACTCGAGCACCTGATCCTCTTCGAACGACCAGTGACCTTTCACAAGACCCGGCTTCAGTACCTTGCGCCAacgctgcagaca
ctgcgCGTGGTTACGACCAGGCACCAACTCAGCGATTGCTTTCCAGTTTTTCTCACCGTGAATGCGCACACTCTCACGGAGGGCAGCATCCTGGCTCTTG
GTCCAGCGCTTGGTCGTCGGAGCCTCCGGGTCTTCCACCGGCTCGGTATTTCCATTGGATTTGTCAGCGTTCTCGCTGTTGGCAGCCATAGGCGTACCCA
TGTCGGAGCGTGTGCGCTGCGAGGGCTTTTGCTCGCCTTCTACTAGTGTGCGGCTGCTTTCTGGACGGTCGCGTTTGGCCGCCGatacgtcgtcgtcctg
tGCAGAAGTCGAATTGCTGTTCTCGCCCGGGATAAAACCTTTCTTGTTGATTTCTAGTTCGCGCAGATTCAGCTCCGAGTCGGCAATGTGCGAGTTGCTC
AACAGTCGTCCCACCTGCGAGATATCTTCCTTGGAAATCACCAcagacgatgacgacagGGAGCGACCGACAACAACGCCATCCGCGTTGGGCATGCCAG
CCAAATGTTGCGCCGTCAGCTTGTGACCATCAGTCTCTTTGCTAGAAGCGCCATAAAAAACATAGAATTATGCCAAGTAAGCAACGGCGTTCGATACTAA
CAAGGCTGCACCCAAACGTACCCATCAGGACCGACCACAGCGTTGAACGAATGGAACTTGTTGGCTCCGCCATTGAGCATCTTGACGCgactggctgctg
caacagatAAGACGACACAGAAGGAATCGTTAGGTTGAATAACAAACAATTCATAGAAAGAATTGCTGCCAggaggatgctgctgctgacgacgacgcac
cgTTGAGCGcctgcttgcgcttgaggtGCGACTCCATGTTCTGTTCCTCCTGGGCCTGCACTTCGGCCATCTTGGCCTGCTGCACGAGGAACTTCTTGCG
CAGGTTCAGGATAaatttcttcttcccctCGACGGTGGACTCGGCCATCGCCTTGATCACGCGGAACTGCTTCTCGTCCCGCAGTTGGTCCACGTAGCGG
CAGAGCTCGGCGCTTTCGCTTGGGGATAGACCGCTGAGCGCCATGAGGAACAGCCGCGACGCCTCGGCgggcagcgactgcagcagttgcgcCAGGAGAT
CGCCGAAGTTGTCGGCGGCTGCAGAGTCCGTGGGCGGCGCCGGCTCCGGCTGGTTATCGGTCGCCGTGTCCGCCATGCTCAAGGAGGTTTGTGGATACGT
AGATAGATACAGGAATCGCTGCTTGGACCGCAAGTGTGCTCTGGAGCGAATATTGCCTTTTGCGCCGAGCGGTCGTTCTCCCCCTTTCGCTTCCCCTCTG
TAGAAAAGAGTTGTGACGTTGGATACCCCTGCGGAATCGGTGGGATTCGTTTTTGTGAGAGATGAATTCTTTATCAAATAAAAATTGCAAAACTATATTC
CCCGTCTATTTCGCTTT