Description :
From Genome Similarity Track
Location :
Scaffold_2:4491- 5871
Sequence
1380 bases(100 bases per row)
CGCTTCACGAGGATCATAGTCCGGACGCCGAGACAGCGCGTCGGCGAGAATGTTATTCTTGCCCGGCTTGTAGTGAACAACGAAGTTGTACTCGGAGAAG
ACGACAGCCAACGGGCCATCCGTTGCGACAAGTGAGGGCTCTTCATCGCTGTCCGCAGCGATGCGTGATCAGTGTAAACCGCAAATGACTGTTCACCGAG
CAGGTACACTCTGAATTTGATCAGAGCGTACCGCATTGCCAGGAGCTCCTTGTCGTGGACTGGGTAATTCTTCTCGGCTGGCTTCAGTTGGCGCGACTGA
TAGCTGATAACGCGTTCGTGTTCGTCATCATCAAACTGCATCAGCGCACAGCCGATGGCAAAATCGCTCGCGTCGCAGACGACGTGGAATGGCTTTGAGT
CATCAGCGAGCTTCAGTATCGGCGCAGACGCCAAGCTCTTCTTCACCGAGTCGAATGCAGCTTGGTGGTCCGATTTCCACTCCCAGATCACGTCCTTCTT
CAGCAGCGAGGACAGCGGCTGGATCAACCCAGCGTAATTCTTCGTGTACTTGTGCAAGTAATTGGCCATGCCAAGCCACTGACGCAACTCAGTGGGGCTT
GTCGGCGTTGGCCAAGCACAGATAGACGATACCCTCTCGGGATCCGCGCGCACACCGCTCTTGCTCACGTAGCATTTCAACACCGGAATCTCCGGTGCGC
AGAAGACACACTTCTTCAGGTTTGCGTAGAGCTTGTTCTCTCGCATCACCTGGAAGACTTGTCTCAGGTGTTTTAGATGTACGTCCACGGCACTGAGGTT
GCCCTCAGCGCGGCTGTGCACGAAGTTGTCGTCGAAGTAACTCGGCGCGAAGTCTCGAAGCGGGCGAAACACATGGGAGACCATGCGATTGAAGGTGGCA
GGCGCGTTCTTGAGGCCCTGTGGCATCACGAGCCACTCCCAGAGCATCCCGCTCGGTGTACTTACGGCGGTGAGAGGAACATCAGATGTTCTCATCAGGA
TCTGATAGAATCCATCGGTCAGGTCGATGGCGCTGTAGATGACGCTGCCAGCCATGGAGTCCAGTACCATGTCCTTCCGAGGGATCGGAGTCTGCGCGGG
GATGGTGGCATCATTCAACTTGTTGAATGCGTGAGCGATACGCCATCCCCCCTGTAGCTTTCTTCACACAGAACGTTGGACTGGAATGGGGAGAGGTACT
CTCACGCACGTGACCCGCCTTTCGGCGGCCCTCGAAGAAGTCATCGATCGCTTTCACTTGATCACGAGGAAGTGGCCATTGTCTGGTGACGCAGTACTTC
GTACCTGGCGCGAGGTCGATCTCATGCTGAACCCCACGATCCGCCGGTAGCTCGGCGGGGATCTCATCCGGGAAGACGTC