Description :
From Genome Similarity Track
Location :
Scaffold_2245:4490- 5635
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2245-fgenesh-gene-0.0Folate-Biopterin Transporter (FBT) family

Sequence
1145 bases(100 bases per row)
CCCCAAGTGACTCGACATCCCACACACCATGGCAACCAAGACCGCCAAGCTCGACATCGCTCAGCGCGCGTCCTACGTGAGCAATGTCTCGAACAAGGAA
GGAGGCGAAGGCTACATGGAGGCCAAGACGCCCGACCTCGAAGGCGAGTCCGGCGCACTGCGTGTTGGCGGCCGTCCAAGCCTCTTGAGCAAGGATTACT
TTGGCGTGATCGGCCAGTACGCAGCGGTCGGGCTCGTGGATGCGGTCCTGCCTTCGACCATCTACCCCATCCTCCAAAACTACCTCAACGCCAGTGGAGC
GACGGCCCTCACGGCGTCCACGCTGGTGGCGTTGCCGTGGTCGTTCAAGTTCTTCTATGGGATCCTCTCGGACTGCGTGCCAATCTTTGGCTACCGCCGT
CGACCGTACATGGTCATTGGCTGGACCATCTGCATTATCATGCTCTTGATCATGGGCTGCACCCCAATGGGCAAGCCGTACTGGGCCAACCCGGCCGACG
CACAGCTGGACCCTTACGCCGACGCTGAGGCGTACAAGGCGGCAGTCGCACGCGCCAACGCCGACGCGCCCAACAGCGGCGCCAAGTACGTCATCATGAT
GATGCTCAGTGCCTTTGGCTACTTGCTCTCGGACGTCTGTGCTGACGCCATGGTCGTGGAACTCGCGCAGCGCGAGCCGCTCGCTGTGCGCGGCACGACG
CAGTCAGCCGTCTACACGACCCGCACGGGCTTTAACATTGTTGGCCAGCTCCTCACGGGCTTTGCATTCAACGGCCACGAGTACGGCGGCTCGTTCGACT
TTTCGCTGTCGTTCCCGACGCTCATGCTCGTGCTCGCGATCTGCATGTGCCCCGTGGTCCCCATGACGTGGTTCTTCATCAAGGAAGAAAAGCACGCGCC
CGCCGTCTTTACCGAGTACATGCGCGACTTGTGGGGCATGGTCCAGTCGCGCGCTGTGTACCAAGTCATGTTCTACTTGTTTTTCGCCAACATGTTTGCC
GGCATCACAACCACGGCGGCGTCTCCCATCCAGAGCATTCTGGTCCATGTCACACCGCTCAACAGCACCATCTTCAGCATCATTGGCTCGTTTATCTACA
TGGTCGGCATCGCATCCACGGGCAAGTGGGGCCTCCACTGGAACT