Description :
From Genome Similarity Track
Location :
Scaffold_1132:449- 2651
Transcript NameFunction/comments
Phypl_g12507hypothetical protein PHYSODRAFT_420719

Sequence
2202 bases(100 bases per row)
TGCGCACGAAGTAGCCTTGCCACTTTACCTGCCAACGCACGACTTGGGACGGACGGGTGCCAAGAGAAGGCTTCGTTGAACGCCGTGACATTTCTTATGG
GAGGTTCGCGCCGCATGCGTTCGTACAGTTCTGAAGACTTATGCACTTCGATGACAAAGGCGGCACAATCTCGCAGCTTTTCAAAACGGCCAcagtcgat
gaagctgtcggagTTGAATAACTGAGTGACAGTGGTGGAGTTTCCCAGGTAGATCGGGATGCTGCCTGCCAGAAACGGATTGACCAACTTTTCCGTCACA
TATCCGGATACACCTGAGTTCTCGAACGCGATGACAAACTTGTAGTTTCGAAACCTGGCTACAGCATCGTCGTTGTACCATGTCGAGTAGCGTGACGCCG
CGTACGACCGATCGGGTAGCCTCGAAGACCCCGCACATATTCCCAGCGCATCGACAGGTTCCACAACGTTCAGGATGTCGAACATGTACTCGCGCTGGGG
TCGATCACAACGAGCGTACAAGTAAGCACAGAATCGTCGTTCCTCGGCCGCCTTCTGTTCGTTAGATGTCACTGCTGGCTTGAGTAGTGCCGTGGGCAGA
TGATCCAATCGTTCGCTGAACGAGGTGCTCGCTACAGTTAAGTAAGCAAACTTTTTTCGATTCAGACCAGCCACCGTAGACAGTAAGAGGACCCTCTCAT
CAAGTCCTTGAGTGTCAGTGGGCTCACCAGCAATCATTATGATCGTCGTTGAGCGGCTCCTTTGATTCACGCCATCAAAAGGTAAATATTCGTCAATATA
GGCTGCAATAGCCTGTTGGCATGTTGGCTTCGAAACAGGGTCACAGTCAGCATCAAGGATAGAAAACACGAAGACATCTGGCTTGTATCCGTAGTGTTCG
CGTAAAATCTCCTCCGGCATGACCAATATTGGACGTTTGTTGTGCTTGTAAATGTCAACAAACAAACACTCTAACACGATGAAGGCAAAACCAGCCTGAT
AGGTGTACGCAATAATTAGTGGTGAGGCGTCTGGATCCGCGGCGAAAAGATTGTATCTCCACAACTCCAGGAATGCACGATCactacttcctgctgcttc
agaagcttcgacgtgctgctggagttgtgCCTGTAATTCCAGAGCGACTGCGCGACACACGAGCGAGTTGCTTTTGGTCGCCTCTTGTAGAGCATACACT
TCAGCGCAAATTCTCTGAGTATAGGCGTTGAGAGTCTCAAATGACGGGTAGTAAGTCACGTTGATGCTATCCTTGTCATCTTTGTCATGGATCGATACAA
CACTCGTAACTTCAAGATACTTCGATGCGCTGAGGTCGTTGATGTAAGTCCGAATATTGACCTCGTTTGCGAAATTATTTTCGAGCTTTATCCACGCCAC
TCGGTCAAACTCGTAACACAGATCCCGTTTCTCAATAAGGTTCGAGTGGATTGATCGAATGCCAAACCGTGATAAATCTGCAAGCGAGAGGAAATCATTC
TTACATGCTCGAATCCGCAGACTCGAAAACGCCGGTGTGTGCTCTACACGCACTTGCATCGTCAATAACCACAGCGCAACGCTGACGTCATCCATTGCAC
CCAAACCGCGCAATCTGTCACTGTTCTTGGAAATGAAGCGCGCACAGTCCATGGAGATCAAATAGTGTGGTCCAAAAGCGAACGGAGGATACGTCTGCAG
CGGGTAGCGGTCCTCTGGAATGTAGTAGCGTGCTGTGGCGTCGCGCACCGGGGTTTGACTTCGACCAAGGATTGTATCCCACACTTGCCCAATGTAGAGT
CGTTGAGAGCGATCTCCCTTTCGTAGCTCGTCGGCTAGCTGGTCTGCTCTGAGGTAAATATCGTCATCTGCGATCATCACGAACGGTGTCTGCGGAAAGG
TTTGCGTTGCAAAGCGTAGGAATTCCTTCACCTTGTTCGGTAGATCTGTATAGGAGTCTTCGCAGCGCAATTCATGGGTTAGTAAATCGCCGTACGTTTG
CTTCTCCATGTCGATGGCTTGTCGAAGTTGCCCTTGTTCGTGAGCACTTTGCGTATTTGTTAATTTTGGTACGCAGCCCAGAAAAACGACTTTCACATCG
TGTGGAAGAACGTCGACGCTCGCCCATGTCTGTCGTATCGCTTGTCGAAGTTCAAAATTTTCCACTACCGCCGTCTTCACTCCAATAATGAGGAGCGTGT
CG