Description :
From Genome Similarity Track
Location :
Scaffold_814:449- 2046
Transcript NameFunction/comments
Phyke_g11097hypothetical protein PHYSODRAFT_469821

Sequence
1597 bases(100 bases per row)
ATGCCCCCGACACGAACCCCTTTGTTGACGAATGTCCAGGTTGTATGGCGCGAATTGAAGGGAACCCTAGGCTTCCTCCCACACGTGGCAGCGCTCATAT
CGTCATTTCTGGACGATTCCGAGCGCTGGAATGTACCTCAAGCTTTGGATTTCGGATATTTGCACCTACTGCAGCGACTCGGTCTCACTTCGCGACGTTT
GCGACCACTTTCTATCCGCAGTTGTTTCCTGTCGGCGGCGCAGCGTGGCAACATTGAGGTATTGCAATGGCTGGCAGTATTCGACCCGACGTTCATTGGT
TATGAAGCAGTACTAAACCATGCAGCTGAACACGGTCAACTcgaagtggtgcagtggctggaCACAACGTTCCCTCGTCTGCAAGCCAGTACCAAGGCCA
TGGActtagcagcagctcatggacATATCAAGGTCctgcaatggctgcatgaacATCGAACAGAAGGCTGCACTCATCATGCAATGGATGAAGCGGGCGC
CCGAGGACACAttgaagtggtgcagtggctaGCAACTCACCGTCAGGAAGGATGCACAAGATATGCCATGAACTTTGCGGTGTGGTATGGTAACACCCAC
ATGGTGCATTGGCTACATGAAAACCGCAGCGAAGGGTGCTCAGTGCACGCCATGATTTTTGCGGCTAAACGTGGAGATCTTACACTGCTGCGTTGGCTAC
ACAAACACAgggtggagctgctgcaaccaaGATCAGATGAAAGTTCACCTTTAATAATGGATCATGCAGCGGAATTTGGTCATCTTGATGTAGTTAAGTG
GCTGcacgccaacaccaccggAGGCTGCACCACTGATGCAATGAACGGTGCAGCAAGGGGTGGCcatcttgaagttgtcaagtttctgctggaaaatcGT
CATGAGGGATGCACGAGTAGCGCgatggatggagctgcacgagGCGGTCACTTAGAGATGGTGAAATGTTTGCATGAACGGAGTCGCGAGGGGTGTTCAT
ACCTAGCAATGGATTATGCGGCTGCCGAGGGGCATGAGGACGTTGTCCGGTTTCTTCACGAGAATCGTCAGGAAGGCTGCAGTCCCTGGGCAATGAACTC
AGCAGCCGGCGGCGGCCATTTAAGTATCGTCAAGTTCCTCCACGAGAATCGGACAGAGGGATGCACAAAACGAGCCATAGATCGCGCAGCCGGTGGTGGG
CATCTTTCCATAGTACAGTTTCTCCATGAGAACCGATCTGAAGGCTGCACTACTGAGGCGATGGATGCGGCCGCTTGCTTCGGACATCTGAATGTAGTGC
AATTTCTTCATGATAATCGACCCGAAGGGTGCACTCAGAATGCAATGGacactgctgctcgttgtgGTCATCTGGACACCGTCCGATGGCTGCATGAACA
CCGTTCTGAAGGTTGCACGAAGGAAGCAATGGACGGCGCAGCCTGGTTCGGTCACATGGACATTCTTCGCTATCTGCACGAATATCATAATGAGGGGTGC
TCGCGGCGTGCGGTGAGGGATGCAGTAATTGGTGGACACCCAGAGGTAGCGCAGTGGCTCACAGACAACTATCCGCAATGCCAAGTAAATGGCAATG