Description :
From Genome Similarity Track
Location :
Scaffold_1271:4487- 5770
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_1271-abinit-gene-0.6Reverse transcriptase
Pytar_ATCC12531maker-par_contig_1271-snap-gene-0.2Reverse transcriptase

Sequence
1283 bases(100 bases per row)
CTTCCGCTCGTACTCGTCCAGCAGGCTTGGCGCGTTCATGTCGTCTTCCGACACCCAGCTCGGATCCGTGTAGCCGACCCACTTGACATGATAATCTCGA
ACCTGTCGGCCGAGTTGTGCCAAACGGTAGTCACGGTGGCCGATGATCGCCTCCACTTCATACTCGCCTTGATCGTGATCGGGCTCGAGAGAGTCTTCCG
GCAGTAGAGCCTCGTCAAAGTCGAAGCGTTGATCAGCTGGGACCTCCAAGGCTTCAGCTGGCCTCGGCTCGAAGTCTCGCCATATCTTTAGTCGTGACAC
GTGTACGACCGGAAAGACTCGATAAGCGGTTCCCTCAATCTCGAGCCGGACGAGATGCTCTGCCGATCGCTCTAGAACCCGAAAGGGCCCATGCCAGAAG
TGGGCGAGCTTCCGCGCGAAGCCCGTCTTGACCTGGTTAATGTAGAGCCATACCTTGGCACCTGGGACGATACCACTTGTGTCACCCCGTGCCGCTCGGC
CGCTTTCCTCCTGTCGATCCTCCATCGCCTGACGCAACAGCCGACTGACATCCTGTCTGGCCTTTTGATACTGCACCTGCACGCTCGATCGCCAGCGACG
CGACTCGGCATGGCCTTCCTGCTGACCAGCATTCGGCAGCACCACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCGGCTC
CCAGCCGTGTAGAAGATAAAACGGCGAGTCGCCACGCACACGATCATGCGACGAGTTGAGTGCAAAGACTAAACCTTTCGGCATAGTCATCCCAATCGCG
CTGGCGGGGGTCCGACACGTACAGCTTCACCGCGTGCATCATGGTCTGTACCATACGCTCTGTCATACCGTTCGACTGAGGCCGATAGGCGAGCGTGGCG
CGACTCCGTTGGCCGATTAGACGGTTGAAGGCGCGGAACACTGCCGACATGCCGGTTCCCTGCCGTGCCGAATGATGCTGCTTGCCCCGAACCGCCGATA
GACACATCGCTCGTACGACTCCGCCACTTCCTGTGCTTCTCTCGACTTGTTCGCACTGACGATCACGAAGCCGGTGTGGTGATCGATCCAGATGAGGAGC
TCCGTGTTGCCTCGAGTCGACTTCGGCAATGACGGTACGTGATCCATGCCGATTATCTCGAATAGTCGGGTCGCGACAAGGTTTTCGGGCGAACGCACGC
TGATCCTTGGCGGCCCCTTTCCGGACTGGCAATCTGGGCAGGCCGCGACGAAGTCGCGCACGTCCGCGTACATGCCCCTCCAG