Description :
From Genome Similarity Track
Location :
Scaffold_51:44862- 53181
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_51-fgenesh-gene-0.10Calcium-dependent protein kinase
Pytve_DAOMBR484maker-pve_contig_51-fgenesh-gene-0.11Folate-Biopterin Transporter (FBT) family
Pytve_DAOMBR484maker-pve_contig_51-fgenesh-gene-0.12Transmembrane protein
Pytve_DAOMBR484maker-pve_contig_51-fgenesh-gene-0.13Protease inhibitor Epi11
Pytve_DAOMBR484fgenesh-pve_contig_51-abinit-gene-0.169OSK1

Sequence
8319 bases(100 bases per row)
CTCGACGAGCAACAACACGACTGGGGACGGACCGGCGCTCGACGGCACTCTCGTACAACGCCTGCAGCTCTATCGGATGCTCAACGGTCTCCAGCAAGCG
ACGCTGAGCGAGATTGCGCGCCTATTGCCGCTTGAGGTCAAGCAGGACGTGGTCGTGCTCTACTCGGAGGTGGCGCGAGACGCCCGAGCACTCGTCGGCA
TCTCCGAGTTCGCGCTCTACATCGCCAACAGCGGCTACAAGCTCACACACGGCGAGGTCAAGGCGTTCCTTCGGGGAATGGACCTCGATGGCGACGGCTT
CCTCTCGGTCGATGAGTTTTGCGCCGCATTGCTCGACTGGTCCGAACTCCAGACCACCTACAACGACGTGTTCGACGCCTGTCGCGCCAAGGTCTTCGCT
CGTCTCGACCGCGACGGGGATGGCCGCCTCGCGCTCACCGACCTCGCGCAGCTCGCGCCGTTTGGGCAGGATACGCGAGTTGGTGCCGGTCCGCCGCGCT
CCTTCCGGCTTAACCTCGACCGCAGCTTCCAGTCCGCTGATCGTCACGGCCGCGGCTGGATCGACGCGGACGAGTTCGCGCAGACGCTGCGCGTGCCTGC
GAACGCCTATCGCCACTTCGCCAAGCGGTTGGTGCCGTAGCACACGGACAGCTGGCGGTAATGACCGCGCAGAGACAGATAGACGATCTCCCCAAGCGCA
CGCATCCAATGTTTGCAGGCGGCGCAGTTGTTGGGTGGGCGGCAGCACCGTCCACGATGTCAAGGTATCGATCTCGAGGGCGAGTGTTGCGTTGGCTGCT
TGCGTCAACGGCAGGTGATCGCGGTGGCGTGATGGTGACACGTGCACTCCCTTGCGATTAGTCCAGACCAGCAGATTCAGTGGACGCAGAATCCGAGCAT
CGGAGCGTCGGGTGGACGAGGGAACGTGCGGGATCCTGGACCTCACCTCGACAGGCGCGTGACGCGCGAAAGTGCGAGTGTGCAGGCGAGTGGATGGCCA
CCGCCGTCTCGCTTTTGGCCGGGGAGTGAATTAGTAGAGTTTTCTGAACATGTTTAGCTGCGGTGAGCAGGTACAGTAGCATGGTGCAGTCGACGTCGAC
GTGACGACTCGAAAATGCATTCAGTGTACGACCAGCCACGGCGGTTCGAGTGCTCTCTTGCCGATCACTCGAGATGAAGTGCTCTGGCTTTGTGGTGCAA
GGAAGAGTATGGAATTGTGGCACAGTAGACCAGATAGCAGTACACCGAATTAGCTGTGTATATACAATTGTGATGCACGCCAAGCAGATCGGTGACGTCG
TTCAGCGCTTTGGAGAGAACCGATCATTCCACATCTCTCCTGGTATTATCCCCGATGACGACGACATGCAGACATCATCCCTGAAGTGTGCATTTCGATG
TATACGCTCAGGTGCAGTCATATCCTGTTTGCTCGAATTACTCGACGCTTTGTACAGGGCACTGTTCGCGTAGTGGATGCCAATCCGCCACAACAAGTTG
AACCGCACACACGTGCCGCTGCGACTTGTGAGGCCGTGATTCCAATTTGAACCAATCAAGAGCCGATAATGTCAAAATAAGCCAATCAGCGGCCAGAATA
TCTGTTAACGAGCCCAATTAACTGCCTCGTCTGCTTGATGACATGTCACGGGAATAAGATGGACGCTCGCATTTCATTGGTCGGCGACACGTGGACATTC
CACACATCCTTCAGAATCGGGATCACGGTGTTCCTAATGATCCAGGCGTTCCTGCGCCCCACTCAAGCACGGATCTGCTTCGCCCTGCCTCACCATGCAC
GATCCCTCCTCCACTCATAGGTGGCGCGGCTCACGGCCAAATCGGAGGCACTCCAACGGTCCAAGAACTCGGGACCATTCTCGGTTTTCCTCTCCAGTCG
CCACGCCATGGCTCTCCAACCGTCAACACCCACGGGCTCCGCTGCCGGCGCTCCTGGCGCGGAGCTTGTCAAGTCCCCGGTCGACTTCACCTCGCTCAAG
ACTCCCGATGCTGAACTTGAGAGTGGTGCGCTGCGTCCGGGTGGCGCGCCGTCCATCTGGTCGCTGCGCAACATCGGTGTGCTCGTCAGCTTCTGCTGCG
TCACGGTCGTGTACGGCATGAGCATCTCGATCTTGTACGCCGTCATGAACAACTACCTGTACATGTCAGGTGTGCTCGTGGCAACCGCCAAGGCGCTCGT
GCAAATCCCGCGTGTGCTGCGTGTCTTCCTGTCGGCCTTCTCGGACATCTACCCCATCTTCGGTTACCGTCGCCGTCCCTACATGATCATCGGATGGACC
GTTGCGCTCGTCGCGTGCTTCATCATGGCCGTCATCCCACTGGGCGATCCGTACTACGAAGACTCGTCGCTCGAAGACATTGACCTCGCCGACATGACAC
CCGAGCAGCTCGCGCTCGTGCACACGGACGCGCCTCACCGCGGCATCAAGTTCATCTTCCTCTTCATGCTCGCCAANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGTGGCTCTGCACGATCGTGACGCTCATCACAATCCCCTTCTGCTGGTACTGCGTC
ACGGAGGACAAGGTCGAGTCGACCGAATCGTTCTCAAAGTTCTACAAGGAGATCTTCGCCGTGCTCCAGAAGCAGCCCTTCTACATGCTCTTCATCTTCC
GCTTCTTCACCAAGATTTTCGCGTCCGTGTCCGTCACGGCGTCCAGTAACATCCAGTCCATGTACGCGGGCGTCACGCCGCTCAACGACGGTATCGCGTC
GTGTTTGAGTCAGGTGCTCGTTGTCGTCGGCGTCTTCGCTATCAAGAGATGGGGACTCCAGTGGAACTGGCAGTACCTCGCCATCTTCTCGCAGCTCTTC
GCCGTCTTTGTTGACGTCTTCCCGACCTTCTTTACCATCTGGGATGTGTACCGCAGCCAGTGGTTCTGGCTCGGTGTGCCTCTGCTTGAAGACTTTGTCG
GTGAGTTCGTCGACTACGCGACCACCATCACCNNNNNNNNNNGTTGAGATTGCCGAACAAGGTCGCGAAGCCACGTCTATGGGGTTCCTCGGCTCCATCA
CCGCCGTCGCCAAGCCTTTCGGCACGGTCATCACCAAGTCGGTCGACAGCTACTTCGACATCGGTCGCACAGCTCTCAAGAAGGACGACCACGCCGTGCA
CATGGATCTGTCGTACGCGTACATCATCGCGTACGCCTTCAACATCATCGCCGTGCTCTTCGCGCTCCTGTTGCCGCGCCAGAAGAAGGAGGCGCAGGAG
ATGAAGCACAACGGCCACAGCAGCAAGCTCATCGGGTCCATCGCCGCCGGCATCTTCCTCTTCTCGGTCGCCTGGGCCATCATGACCAACATCCTCTCGC
TCTGGGACTCGACTTCGTGTCTGCGCATCGCCGGCGGTAGCGGCTGCTAGGTACCGGTAGTAGCATCAGGCATTGAGCGTCGCCTTCCCTTGGCGCCAAT
ACAGTGACTTGTCTGCAGAATGCACACTCGGTCTTGCGTCCTCAACCATTCATTTGCTGTTTGTCCTTGCTGTCGGGCGAGCAGAAGAGTCAAATGCGGA
GCGCCCTCGCCCGCACCAGGCGCATACCTCCAACACCATCCATCAACTGGAGCTCGGTGGGTTGTCATCAGCGCGTTGTTCGGCTCAAAGGTTGAACCTT
CGGGGAGCTAGGAACCCCTCGGCGATTTGCTGGCTGCACGGTCTCGAGGGATTGCGTGGCGCTTGCTGATCGTGGCCGCGCGATCATGGCGGTCGTGTGC
CGTGACGTTGGCAGTCGAGTGTACACTGCGGCTCACACTGTATGTCTCAGCGCGGTCTCGCGCTGATTACATCATTGTGTCGATGGATGCGCCGTACACC
ATCCAAGTCGCTCGGGATTGCGCTCGACCACTGTCGAGGCCTTCGCAAATCACTGCAGCACCGCGCGAGATCCCTCGCGCGAGCAGTCTCACATCGTGGG
ATCGCGCGACCACCTTGAGAATCCACACAAACTCTGGATGCGCTGGAAACTAACAGCAAAAGTTGAATGCGATTGGGTGAACAGCAAAGAGACCTTGTAC
CGCGTCAACAAATGTCGATGGCAGTCGTGCAGCCAGCTGGTCCAAGTGAATAGCGCCAACTTTTCGGCAAAGGCGGCTGCACTTGCGCGATGCCTCTATC
CAAACACGACCGAGAAGTGAGATACAGCGCGAGATATATCTCTTTGAATGGTGCGGTGTACCTTCGGCGACTAAAGCTCAGTCCATTGATTAGCCGGGCT
AATCGAGCGAGAGTGGATAATCACCTGTCTGTGTACACCTCTCCATGACGGTTGCCCTGTCATTGGTCCGAGGCACGTGGACGCCTGTGCAACGAAAAGG
TCCTCCAGATCTGATGCAACACCATGTGAGCCCGCGCTGTTAACACAGGTGACGATGTCGCCCCTCGAGCAAGTCGGCTCTTCCACTCGCCAGTAGTGAG
GTCAAGCCCTTCCATTCCTCTGTGGGTCGAGACTGCCCAGCTCGTCCATTCACTCGACCGGACCGACAGTTCTGGGACCTTGGACCTCGATCTCATTCCT
GGATTTGCGCTCGCCTCGCCACACCATGGCTCTCCAAGTTTCGTCTCCAGTGTCCAAAGGCCCCGAGCAGCTCGACCACGCCAAGTCGCCTCTCGACTAT
GCTCCGGTCAAGACTCCCGATGCTGAACTTGAGAGCGGTGCGCTGCGACCCGGTGGCGCGCCGTCCATCTGGTCGTTCCGCAACATCGGTGTGCTCGTCA
GCTTCTGCTGCGTCACGGTCGTGTACGGCATGAGCCTGAGCATCCTGTACGCCGTCATGAACAACTACCTGTACATGTCGGGGTTGCTCGTCGCGACGGC
GCAGGCTCTCATCCGGATTCCACGTGTGCTGCGTGTCTTCTTGTCGGCCTTCTCGGACATCTACCCCATCTACGGCTACCGTCGTCGTCCGTACATGATC
ATCGGATGGACCGTCGCCTTCATCGCGTGCTTCATCATGGCCGTCGTGCCGCTCGGTGACCCATACTACGAAGACTCGTCGCTTGAGGGTATCGACCTCG
CCGACTTGACGGAAGAACAACTCGCGCTCGTTCACCCCGATGCGCCGGACCGCGGCACCAAGTTCATCTTCCTCTTCATGCTCGCCAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCGAGCCGGAACACATGCGTGGTCGCCTCCAGACCAACGTCATCATGGTGCGCAACGCTGTCGGCGTGCTCACAGCAT
TCCTGACTGGTCTGTGCCTCAACAGCACCGAGTACGGCGGCACCTTCTCGTGGACGATCGGCTTCAACGGCATGATGTGGATCTGCACGGTTGTTCTCGC
CATCACCATCCCGCTCTGCTGGTTCTGCGTCACGGAGGAGAAGGTCGTGCAGACCAAGTCCCTCGTCGCCTTCTACAAGGAGATCTACGAGGTCTTGCAG
ACGCGTCCGTACTACCGCCTCTTCATCTTCCGGTACTTCACCAAGGTCTGCTCGTCCATCTCGGTGACAGCAGCCAGCAACATCCAGTCCATGTACGCGG
GCGTCACGCCGCTCAACGACGGTATCGCCGGATGTCTGAGCCAGATCTTTGTCGTCATCGGCATTTTCGTCGTCAAGCGGTGGGGACTCCAGTGGAACTG
GCAGTACCTCGCCATCTTCTCGCAGATCTTCGCCGTCGTCGTCGACTCCTTCCCGACCTACTTCACCATCTGGAACGTGTACCGCAGCCAGTGGTTCTNN
NNNNNNNNATCGAGATCGCCGACGTCGGCCGCGAAGCCACGTCCATGGGGTTCCTCGGCTCCATCACGGCCGTCTCGTCCCCGTTCGGCACTGTCATCAC
CAAGTCGGTCGACAGCCACTTCGACATCGGCCGCTCTGCTCTCCAGCGCGACGATCATGCCGTGCACATGGACCTGACGTACGCGTACATCATCGCGTAC
CTCTTCAACCTTGCTGGCACGGCGTTCGCGGTGCTGCTGCCGCGCCAGAAGAAGGAGGCGCAGGAGATGAAGCAGAGCGGCTCCAAGAGCAAGTTCATCG
GTACAGCCGTGGTCGTCGTCTTCCTCTTCTCGGTCGCTTGGGCCATCATGACGCACCTCCTGTCGCTGTGGAACTCGACCTCGTGCCTTCGCATCGCTGG
TGGCAACGGTTGCTAGGCGAGAGCGAGTCTTGGATGGTAGCGTAGATCGTATGAATCCGAGCTATCCCCTCATTCTGCATGAAAACAAAGTGTGCCTGTT
GAGTGACTGGTTTCAAATAGACTGACGTGCCTCTTCCGAGTCGCCTCCACATCTGCACATCGTCGCCCAGCCGTGCTGTGCAAAATGCCGATCCTCTCTC
GTCGTGTGGTTTCCAACTGGCAGATAGCGCTGTTCCTCCTCTCTGGAGTCCGCGACGGCCTCGACCATGCGTTTCCCTCACTTGGCATGGTCGTCGGCGA
TGAGCACGTCTTCAAGGCGACTTGCACGAAAGTCTGTGGGCCGTTCGAGACATGCGTCTTGTTCAACAACGACGAGTACTGCGCACAAAACTGCGCGCCA
GGCCGATGTGACGTCGAGAAAGAGGTCTGCATCCTCCAGGGCGTGCCTTGCGACACCATGCCGTGCCTGCCCGTCGCTATCTGCGAGTCCATTTCCACTC
AAGGTGCAAACGCGCAAGGTGCCGACGACACTACAGACGACGACCAATCTTCGCCTCTGTGCGAGCGCGAATGTCCACGCATCCTCTCGCCAGTCTGCGG
CTCCAACGGCGTCTCATATGCCAACGAGTGCTTCTTCGAGCGAGCAAAGTGTCACGCTGGGGACGACGCCGAGCTGACAATCGTTGACTACACGCTCTGC
GCTCGCGATGTTCAGCGCAACGAACTCTACCGTCCACCCAACGACAATACAACAAAGCCGTCGTCGCCCTCGGCCTGCGACAACATAACGTGCGCCAACC
TGGATGTGCCTGTCTGTACGACGGATGGAACGATGCAGAATATCTGCATCTGGTCAAAAGAGGCATGTCGACAGCAAACCTCGGCAGGAACCGGCGATCC
TGTGACGATGTTGCGGACTGGCTCGTGCGAAGAATCAACAACCGACACGTCCGAGTGTCCGAAAACGTGCTTCACCATCAACAGCGACCCGGTGTGCGCC
TCGAACGGCATGATCTTCGGCAACGACTGTCTTTTCCGCCAAGCTCGATGCGCTCGTCCGTACTTGATCGGCGGACTCACTCGACAAGCCGACTTGAGCT
TTTGCGAGTGATGACATCCGATCTACAACAAGGCAAAACACACAACCAACCACCCAACCAACCAGACAACCAATCAACTAGCCAATGAATCAACAAACCA
ACCCGCCAACCAACACCCACAGAACATACCACACAGCAAGTATCGGTTCAAAACGTACGTGATCTTTGGGTTTATCTGCTCGCTGGCGCAGACGAGAGAT
GCATCTCAGGAGTCCTGGCGTCGCGGCTGTCGCTATCGTTCGTGACCGTCGTCATCGTCGCTGCAGGTCCGCCTCTCGTATACTAGCTAAGCTTCGACCG
CCACCCACGGGTTGCGCACTACGCACCGGCCCGCTCGACGATCGCAGCGTCTTGGCAAAAAAGAAGAGACTGCTGGCAAACCTGGCATCATTGCATGCTC
GCTTGGTGCGGATTGTGCTGGTGGATGTGGACTGAGCCGTGGTGGTGCAGCGTGGGGATCCCAACGCCAGAGCCGTCCCCGAAGCGCGGGTCGTGGCCCG
GCGCCACCGGTCGGATCCCCGAGAGCGTCTTGAGCTCCGTGATGATGCGCGCACAAAGGTTCATGTACATGAACGCATTGCCCTCGAGGCGCTGAAAGTC
CAGCAGGTAAATATGCTGCTGCACCTTGTACAGCTGCAGCCCAATCTTGATCTGCGACTGGGCCTGAAAATGCTGCTGCATCTTGGCGTCCGTCATCTCC
GTCGAGAGACCCTTATTCAGCCACCGACACTTGATTCGGTACGGAGCGACGACCTTCCACTCAAAGTGAAGAACGAACAGGGCCTTGTACACCTCGGACA
TGACGTGCGCCGGCTCCTTCTTCGACTGGATGCCGAGGTACCACCGACGGCGCTTAGGAGCAGGAGTTCCGCCGTTCATCACCGCGCCTTCTTCAAGTCC
ACCTTGGTTCATTCCTGACAGTCCCGAGTGTCCGGGATTGAGACGCTGCTGAGGATATCCACCCGGAATATTCCTGCCGCCAAACTGCCGACTGTCTGTT
GGAGTGACTAGCGGTGATG