Description :
From Genome Similarity Track
Location :
Scaffold_178:44861- 51552
Transcript NameFunction/comments
Phyke_g5981hypothetical protein PHYSODRAFT_545950

Sequence
6691 bases(100 bases per row)
CATCTACGGTGCGCTGCCAGCGGGCGACTCGTACATCTGGTAGTTCGAGTGAGACTTCGCGCGAGAGCGGCTGAAGTTTCTTGAACGCGCACTGCCCGGC
GTGCGGGCGCTGCGTCGAGACGCACGGATGCGGCGTATACGTGCCCGCTccgcctccatctcgcccTTCGTGCACACCATGCCGTTCTTTAGTGTGCCAA
CGGCGATCAGAAGCACCATCGCCACGATGCAGCAACCAGCCAGTGCGAACATGTACAAGTATTCGTCGCCGCTcatcgaagagctggagcggATGAACGT
GGCACACACCGGCATCAGGAAGAACACCATGAAGTAGACAGTCACATACACCGCGCGCTGCCTGGTGTTGAAGAGGCCAACACACGACACCCAAGGCACC
GACGTGATGCCCAGACCAGCGAAGAAATAGAGCAGCATACCCAcgatctgcagcatcaggTACTCATCGTCCCCAGTCACAAACTCCGACTTCTCATTCA
GTCCCAGAACGAACACCAAAATGGCCACTGGTAGCAACGTGCAGAACAGGATACGCCTGTGGTCCACTCGgtccatgaagaagaacgagaatAGGGCACC
AAGGAACTGTAGGCCCATGCAGTTTACGAACATGTATGTCGCATCCTCGATGCCGCGGAAGGTATCCGAGAGATACATATTCACACAGCCCAGGAAAATA
CCCGACACTAACATGAGCACCAAGCCCATCACGAACTTGAGGAACGACGTACCACCGTTGGCACTCGAGTcgtcgcttccagcttcCTCGTCACGGATCA
TACGCAGCTCCTCAGATACACCTTCCTTGCGGCGCAACACGGCAAGGCATCGCTCAGACGACTCCAGGCCCTCACGCATGTACACCCAGTAGGGACTCTC
AGGGAAGATGTAGACGGCAGGGGTCATGATGGATAGGATGATGGTCGCTATGAACACCTGCCACACCCAACCAACTTCgttcgacgacgaagaaaaccAT
GCGGCAAACAAGATGCCGAGAATGAAACCActgccgagcagcagcaacgctTTGCCACGCATATCACGCGTGGAGATCTCGTAGATGTACATAGCCAGCG
TAGGCAGAAGTACACCCACGGAAGCACCCAGTAGGGCAATACCAGGCGTCAGGAAGCCTTCGCCACCCGACTGCACAGCACTCACGCCAAGCATGCCGAC
GACAGTCAACAGACCGCCTAACACAATCGTCAGCCGGCGACCAATGAAGTAGCTCAGGAACCCGGCCGCAAACGTACCGACGAGGCAGGCAAAGTAGAAC
GTGTATGTGACCGATCCGTCACCAACGTTGCCGTCAAGCAGATCGTACGTTGTCACATAACTCAAGAAGCCAGCCGTGCTCTCGAGGATAGTGAACAGGT
GGAACAACCAACCGCAGCCGATTCCGCCAAGCACACCCATGAAAGCGGCCAGCGAGAATGCGTACTGCGACGAGGCAGACACGACCTCCGAGAAACCCTT
GTTATACATCATACGCGTCTGGATGATGTTCAGGAATGGGATAGCAGACATAACCAGCAGTGGGGCGATCATAGTCACCGAAAAGacgaagtcgaagaag
aacgcTAGCTGCTGGAACATACCAACAGACGCGACGGACGAGTTGGCGAAGCTCCACATGCGCACCATCTCGTTTATGCCATATAGAGCCGCCATGTAAC
CGTAGAAAAGAGACATCGTCCGCGTGAAACTTGTATCGGAGATCACAATCGAGCCCACGAAGAATACAATAAGTGCCACGAGCAGGACGAACACATACAT
CATAGCGCGAACTGATGAGTTGACGTTGCGGAAGCAACTGCCGACCGCACCAAAGAAACCCATCGCCACCACAGTgaccacagcagcagcgaacACCAAG
CCCACGGAGAGGATGTCCCACTCGAGCGCTACCACGTACCACATAAGCAGGAAGTGGCGAGCTTCACGAAGGATAACCGTAACTCGAGCAATAGGCTTCG
TGTTGTGGTAAAGGCTCAGCTCACCCTTCCACCAGCCAATCCATCCACCAACCATCACCTTGTCCTCGTCCTTGTAATCCTCGCTAGCATACATCCACTT
GGCCCACGCCGTCACATCAGCCTTAGTCTTCTCCCAGTCAAGTCCGTCTGTGTTGAAGATGTACGGCGacaccagccacaccacGGCAATGACCCAGATG
GCAAACGTCTGCACGCCAAAAGACTGCGACGTATCACAGTAGTCGAAGGCAAACGAGTTCTCTTCGCCTGCGACGGAGGTGTCACAAATGTCGAATTTGC
CGAACGTCAAGTAAACCAAACATAAACCGACAAGCTCCATAGCCTTACGGTAGTGACTCGGTGCGTACGCTTTGTACAGCAGTACGAACGTCTCACGCGT
AATCTTGAATCCACGCCCCGTAGCCTTGTACTGAGCTTCACCGtgcagcaagttgttgtcgaagaagtGCATCGTCGTACCCAGCTGGAAAATGAAGAAC
GCCGGACCGGCGGTGAATACCATCTCCAGGAACTGCACAAGACCGCGACGGAGACCCATTTCGGCAAAGTATACACAAATCAGCGGCAGCGACAGGAACA
AACCAGCCTGGATGTAGTACTGGGTGTTGTACACCGAGTCCATATCGTGGTACACTCGGGTATCAAAGCCATACTCCAACGAGTTATCCATGATGATGTC
GGTCGTGTTCATGTTGTACACAATCTGTGTCTGCACACCCGACAGCGCGATGTAAACCttgcagtacatgtacacgaaCGTTGTCACAAtcgtcatccac
gtcgcGTAGTAGAAGCCAGTGTGCGAGTAGTACATGGAGTTCAGACGGAAGAAGTCCATGAACTGGCCCATGCGGTGAGCCTCGCGCGCCAGAGAAGTTT
CGCCAGCACCGTTCGCCAGCTTTCCTTCAAACATCGAAATTTGGGATAGAGCCACATCACGGCCCTTACCACActgcatgaactccacgTGCGTCACGAC
GCCGCCACGCAGCGTACAGTTGAAACCAGCGAATACATCTTCGGACAGATTAATACCCTTACTAGCCTTTGACACACCACCGCGCGTGATAGCCAACACC
TTGTCGAACACATCAGGGTGTCCGTAGTGCATACGCACGTACAGAGGGTCGGCCAGGACACGTTGCGATAGCGTCACGAACACCAGTTCCTGCCacgtct
tgaacttggcaAGCGAACTAGCGTTACCTGTGAAAATGTGCTCACGCATACCGATGATCGACACGGGCTTCTTCGACGGGTGCAGGTCAGCCGTGCACAA
CAGCTGCGGCATTTTTAGACACTCTTCGAAGTAGTGCTGTTGGTTCATATCAATCGTCTGCACGAACTCGCCACGTGTGAATGGGATAGCATTGTTTTGG
TTCTCAGGCTTGCCCTCACCCAAGATCGGGTCGCCAGGCAGTTGGTAGCGGTACACCTCCACAATATCATCATGCTCGCTCTTGATCAGCACCGAGTCGA
ACGATTTATCGCCGCCCTCGTGATCCACCGTGTCCACATAGGCCACACGCAGGTTCGGGTACTCGCGCAGCAGGTAGTCAATGTCAGCAGCTTGCTGTTT
GCCCTCCAAACGGTGCTTTCCGTACACTTGACAAGCACAAATGTACGAGAATTTCAGTCGGACCATATCCTGCAACTgcgcctgcttctgctcggcCGAC
TTGCCAGGGCTCGAGCCAATCTCCAGCCAATGCAAGATCTTGATGGCATCCTCGTACATCATCATGCCCTGCACTGTACGCGCCAGAGTCTGACCACGGT
ACGACGCCCACAGGCGAATCTCTTCCGGGTGGTTCTTCTGAGCTTCCTCAGCCGAACTCACATCAACACGCTCCAAAAAGTTGTCCCACTCCTCTTGATG
GATTTTAGTCAAGTACTTCAGGATCGTCAGATTTTTCCCatcctcttcaacttgttggAAAATCGGGTGGTTCACCAGCGGATTATTCAGATCTTCAAGC
GAGAACAGCACCGTCTCAGCATAGAACGGCGTCACCACCGAAAAGCTGCGCATTTCCTTGATAGATCGCAGCTGTGGGATATCCATAACCAGCGACTTCA
TAAAGAAGCCAAGACGACGTTGAGCTTCCATTGTACGGGGCATAGCCTCCGACCGGTCAAGAGATAGTAATAGACACGCACGGGTAGCGGCACCCATAGC
GGTATCACTGCAGAAAAGATTTACCAGGCCGCGCGAGGCGAACATGTAGCCGTTGGCACTGGAACAAAACTTCGCGTTGGCGAACTTGCGCTGCAGAGCC
GGGTCCACACAGAACGACTGCACACCGTTAAGGAAAGCCTCCATCTTGGACACAAAGTTGCGGATCACACCCATCGAGTGCACACGGGCATTGGGGATGT
GCTGCGACTGAGCATCTGGGTCAGGTAGGTCCAGAATTTCCTCCAACAGATCCACAGCTGCCACACGCAAACTAGCCAGTTCCCGAACGTTGAACGACTT
GAGGAATCCGCCACTAGCAGCAATCTCCTCAATCATGCGGAATCCGTCTACGACGTCCGCGTCATCATTACCGAACAATGCACTAATGACGTACATACTG
GCGGTGAAAAACGATCGGATTGCCGATAGACAGTCATTTTCCACCAGAGTGACACGTAGTTGGCTCTCGCCCTTGCCGTCCTTGGCAGTCTTGATTGCTA
AACCCATGGCTTCCGTCAACTTGCCGGCTGACAAAAACACAGGCTCGAACACTTCGCCAGTGCTGCGAATGTCGTACTGCAAGATAGCCGCctccttgtc
gtccagcAAATCTCCCTCACGGAAAGAGTTGACAATTTCATTCCACACCACCACGAAGCGAAGCATCATCTGCGATTCGtaagcagcagccaaagcacTG
GCACGGGTCGAGTCCGTACCACTTGCCGTTGCATCACTGGAACGCGCCAGACTTGTGACCACTTTTTGGTCAAAAAGTTGCGGCGCCACACGGAAAGCTT
TCGTCATCTCTTTAGCACCGCGAATTTCGCCCGTTTTCATGAGAATTCCCTGGAATCCGCCCAAAAGTGCCTGAAAAATCGTAAAGTAGATTTGAGTCGC
GTAGTTGAAGATAAACACAATGGGCAACCAAAGCGCAATAATGACGCCCACATTGTGGAACGAAACCAACGAGTTTTGGTAATCCAACGTCATCGCGTAA
ATGCTCAATGATGGCAACATTAGTGGCCGAACCAGCACAAAATACGACACAACGCCTTCTATGGCCCACAGGAGCACCCAGAACACAATATACTTGATCT
GATATGAGAGCGGAGGCGTCATATCGTGTCCGACATAGCAACTCGCCCCTTCACGCACAAATTTTGCCGCAAAAGTGCCGTTAATCACTTGAGGGGAAAA
CGCCTGCGTAAGCAGGATAAGTAATCCTGGCAAAATATAGGCACCGCATAATGGGTACAAGTTGTccaacagcgtcgtgtcCTTGTCTTGGTTAAGTGGC
ACGTAAATCATGACACCAAACAAAATGGCGAAACCGCCATTCCAAATGATACGAGTGGCTAACGCCGCCCCATAAGAGAAAGACCGCGAACTAGAAGCTG
AAGATTCCTTCGAGGTTAGGAGATGCCATCCGTGGCAAACTTCCAACACACATTTCAGGAAACTCATGACACTGAGCGAAAACGGAATAGACACAATTGC
CACCCGCAAGTCACGAGTAGTAAATGGgtccaccacgtcgccaATGCGACCGAACTGAGACCAGCCACTTTTGCCTCCATCCGGGGAAATGGTCACGGCA
AATGACAAGACCGTGAGCAACACCATAAACATGATATTGAACTGGAAGATACGGTAGTAGTTTAGCACCAGCGTAAACAAACTTCGGTGTTCGTAAAACG
TCTTGCCGTGGTTTTGGGTCAATTCTGAGCCCACATTTTCCACAGGGATGCTGAGACAATGTTGCTTCCAAAAGTACTCGTTAATGTCGTCGTAATTGCG
AATTTTCACGTGTTCCAAAGGTTTCCCCAACGCATTGCGCCGTTTCATGTTGCTTGCCTCCCTCCAGATAGGACGGATCACTTGGTTTAGGTACCACCCT
TCCGGTTGCCGTTCCCGTCCTTGAGGGTCCGCGTTAACCAGCATCATCATTTGATGGTACAAATAGCATACACATTCTGGCATATGACGGACATTGGCAG
CTTCTCCCCAAATGAGGAAATACAGCATAACGTCCATATGCAGTTGCCCCGACATATTACTGGACGCCCCTGTCGCGTTAGGGATTGCGGATCCTGTATA
GGAAACCGGTTGAATGTGCAAAAACTTGCACCATGAGTGGTAGTTGCTGAACAGTTTCTCAGCCAATAGCACCAAATGTTGATCCGCCGGGTCGCTCGGG
AGACATCTCGCCTTGCCGTTTGCCAAAAGCAGTAGCACATGTTCGCGCTGATTACTGGCCGACCCTTCTTGAAACCCAAATTTCACCTTGAGAAATTCAC
AACAATAGTCAATTGCCGTCTCGTCGTCCTGGCCGGCCACCCCCGCCTTCAAGCCCCCGGACGTCACGTCCATGGTATTGAGGCGGTGGCTGAAGCGCTC
TGAGCGCTCCGACTTGTTCCTGCGGCGATCAGCGTCCAATTCGAAGTAGTTGGAGCTGGCACGGCGACGGCGATCCATCTCGCCGTGGGCT