Description :
From Genome Similarity Track
Location :
Scaffold_13:448601- 449701
Transcript NameFunction/comments
Phyin_T30-4PITG_08266Putative uncharacterized protein

Sequence
1100 bases(100 bases per row)
TCCCAGTACGATCGGGTCGGTTGGCCTTGACAGCGCGCAGTAGCCTACTCAGAAGCGTGGTCACCTTGGTTCCTCGTCTTATCCGTAGCCTTGGACTAAC
GTTAACTTTGTGATGGTTTACAGCATCAAGACAGTAGATTGGGAGCTGGAACTCCCACTAACGACAACGTGTATGGCTCGTTAGGAAGCTTATTTGATAC
TGATCAATTCCTACGCTCTTACCCTGCCAGCCCTGGCAGTCCAGGAAGTCCGCATTGATTGCTCCATACGAGGCCAAGTTCAAGCACGCCTTTCCATTTG
GAATGCTGAAGCGCCTAGTTAAGCTTTACATAGTAACAGGTGGTAGGATACTTCCGACCGTCACACTGCCCTCCAAAACTTCACTAGCGCATGTGGCCCT
CGTACGAGGCTTGTACTGTAGACGCAGGTCGCACTACAAGAAGTAGAGCGCCGTCGCCACGCAATTGCTACAGTGGTACATCGTACCAATCAACCAGCGC
GGAATTCCAAAAGGCAATTCCCACAGTGTAACACCGCTGCGTCTGCAGCGTTAGCGTGCCCCGTGTCGGACCACGCGCTTTCACACCACTCGGGTTTTGA
CAAGCCGCGATCTCGCCGCATATTCCAGGCCTACGCTGGGCACGACGCCTCTGCGCCGTTCCACAACACTACTCCCGCCCGAGCTATTAATGCCTCGGCG
CGTCACGCCAATGCTACTGCTGCCCCAGTACGGTCGGGACACTTAAGCTTGGTGAGACCTCCATCGTAGGGGTCGCAACCGGTTTGCCGTTCACTTGCCA
AGTTGCCGCTGCTCCCAGTACGATCGGGTCGGTTGGCCTTGACAGCGCGCAGTAGCCTACTCAGAAGCGTGGTCACCTTGGTTCCTCGTCTTATCCGTAG
CCCTTGGACTAACGTTAACTTTGTGATGGTTTACAGCATCAAGACAGTAGATTGGGAGCTGGAACTCCCACTAACGACAACGTGTATTGCTCGTTAGGAA
GCTTATTTGATACTGATCAATTCCTACGCTCTTACCTGCCACTCTGGCAGTCCAGGAAGTCCGCATTGATTGCTCCATACGAGGCCAAGTTCAAGCACGC