Description :
From Genome Similarity Track
Location :
Scaffold_18:448566- 450370
Transcript NameFunction/comments
Phyca_LT1534506238serine hydrolase (FSH1)-like protein, putative
Phyca_LT1534527340serine hydrolase (FSH1)-like protein, putative

Sequence
1804 bases(100 bases per row)
ctttcccgtccaagaagctccgtgtgttgtgtctccacggcttccggacgaaccgccaagtaatggagagtcaaacgcaggggctgcgagaggctttggg
ccctaacaccgagtttgtctttcttaacggaccgttcgaagctcgcggacctaccgatgagatcattgagcacatatttggccacacctctccattctat
gaatggtggggtgcacgatcgttagagaaggaagaacgcgacgacgttgaggctgaagatggagttccaagaggaaccacgaagcgctggtgcctcgaat
tcgacgatatcgaccaggctatcgagtacatggatgataagctgaacgaactgggcgagtttgacctcgccgtgggcttttcacagggctccattatgct
cacaattctgacaatgtggtatctcaagaaggccaacaagtgctggtggaaactcgtgctctgcgtttgtggcgtgtatccacaaggcattaatgtccgc
gagctctttgaaacgcatgaaggacagtcgattaaggtgccgataccgtcgatccacgtcgtggggaagaaagacagtctctataaagcctcactggtgc
tcaaggacatgtatacagagcaccctaagggcagtcccttgccaagactcttgctagagcatgatggtggacataaattcccaactccaaagcgaaacaa
acagttctacgccgatttggccaacacgatttggcggttcttcgaagacacgcgccagagctctgtggccagactttagatacaaccaccagaatacatt
tgacgtttacttcagtttcttgaaaggatgacgatgccttatccttgcgctctctccgatttgtgtgtgcgtcatcgtgcttgaagttgaagaggctcag
gcctctgttcagtcgacattttgcagcgcgtctgacactaatcatggtgatcgtcgctgagaatttacctctacctaaggcgctacatccgcctccattc
gagtcctccaagaagattcgcgtgttgtgtttacatgggtttcgcaccaacaaggaggttatgcaggatcagactcgtggacttcgagcggtgctggggg
attctgctgaattcatgatactgaacggcacgtacgaagctcgcgggtcgagcgatcccatgattgatagtgcatacaagtccagcgccccgttctacga
gtggttcgagaatcaactggctgacggatctccgctccagtacaacgacgccgaatcgtccgccaaggcacgtcttctaagtggcgcggacaaaggagaa
gaccacgcgtggagtttatcctacaagggtatcgagcagtcgatggtccgaatcgacgaggagcttcgtcgtcatggcccgttcgacgttgtcattgggt
tttctcagggtgcagcgctactgacgattctgacgatgtggtacctgcgccacgggaatgtccgttggtggaagctggtgatctgcgttggcggtgtgga
tgtgagtggtgtcaatgtcaagtcgctgtttctggataaagcgggcaatcgcattctcgtgcctctgccttcgatccacctcattggcaagacggacccg
ctctaccatgagtcacatcgcttggcattgtcgtggacagataaagcagagctgaacgatttcaagaaacggatctacgttcatgacggtgggcacaaat
tcccttccgtttcgatgaaccgtgagttctacgcggagctgggccaagtgatcaaacagcactgcaacaaagatttggaaacatcgacagctagactgta
agtg